Incidental Mutation 'PIT4520001:Cyp51'
ID555166
Institutional Source Beutler Lab
Gene Symbol Cyp51
Ensembl Gene ENSMUSG00000001467
Gene Namecytochrome P450, family 51
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4520001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location4081145-4104746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4101200 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 143 (V143A)
Ref Sequence ENSEMBL: ENSMUSP00000001507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001507]
Predicted Effect probably damaging
Transcript: ENSMUST00000001507
AA Change: V143A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001507
Gene: ENSMUSG00000001467
AA Change: V143A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:p450 61 496 1.9e-76 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit skeletal and craniofacial abnormalities and die at late midgestation due to heart failure resulting from cardiac hypoplasia, ventricle septum, epicardial and vasculogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Cyp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Cyp51 APN 5 4083247 missense probably damaging 1.00
IGL02047:Cyp51 APN 5 4099244 missense possibly damaging 0.86
IGL02191:Cyp51 APN 5 4100147 missense probably benign 0.05
IGL02492:Cyp51 APN 5 4104304 missense probably benign 0.01
IGL03209:Cyp51 APN 5 4104195 missense probably damaging 1.00
PIT4515001:Cyp51 UTSW 5 4099122 critical splice donor site probably null
R0535:Cyp51 UTSW 5 4099202 missense probably benign 0.00
R2048:Cyp51 UTSW 5 4086636 splice site probably benign
R2165:Cyp51 UTSW 5 4086594 missense probably damaging 1.00
R2851:Cyp51 UTSW 5 4099183 missense probably damaging 1.00
R3975:Cyp51 UTSW 5 4091877 missense probably damaging 0.97
R4799:Cyp51 UTSW 5 4083256 missense probably damaging 1.00
R5699:Cyp51 UTSW 5 4101213 missense probably damaging 1.00
R6163:Cyp51 UTSW 5 4100199 missense probably damaging 1.00
R6484:Cyp51 UTSW 5 4086627 missense probably benign 0.07
R7046:Cyp51 UTSW 5 4100188 missense probably damaging 1.00
R7155:Cyp51 UTSW 5 4087846 missense possibly damaging 0.90
R7877:Cyp51 UTSW 5 4102929 missense probably damaging 1.00
R7904:Cyp51 UTSW 5 4100173 missense probably damaging 0.99
R8094:Cyp51 UTSW 5 4086490 missense probably benign 0.08
R8095:Cyp51 UTSW 5 4086490 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGGTTTCTTTCCAAGTGTCAC -3'
(R):5'- ATGACCAGATGAAAGCATTTGC -3'

Sequencing Primer
(F):5'- TCCAAGTGTCACAAATTGTCAG -3'
(R):5'- GCATATTTGGAACTTTTCAGCAAAG -3'
Posted On2019-06-07