Incidental Mutation 'PIT4466001:Mib1'
ID555809
Institutional Source Beutler Lab
Gene Symbol Mib1
Ensembl Gene ENSMUSG00000024294
Gene Namemindbomb E3 ubiquitin protein ligase 1
SynonymsMib, mind bomb-1, skeletrophin, E430019M12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location10725548-10818704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10775541 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 498 (D498N)
Ref Sequence ENSEMBL: ENSMUSP00000054428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052838] [ENSMUST00000165555]
Predicted Effect probably benign
Transcript: ENSMUST00000052838
AA Change: D498N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000054428
Gene: ENSMUSG00000024294
AA Change: D498N

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 72 5.6e-21 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 219 4.9e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114289
Gene: ENSMUSG00000024294
AA Change: D132N

DomainStartEndE-ValueType
ANK 65 95 1.63e3 SMART
ANK 98 127 2.1e-3 SMART
ANK 131 160 2.47e2 SMART
ANK 164 193 6.02e-4 SMART
ANK 197 226 1.14e-4 SMART
ANK 230 261 6.26e-2 SMART
ANK 266 296 1.24e-5 SMART
ANK 300 329 9.27e-5 SMART
ANK 333 364 1.04e2 SMART
RING 454 488 1.8e-1 SMART
RING 501 535 1.9e-1 SMART
RING 598 630 4.58e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165555
AA Change: D498N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131712
Gene: ENSMUSG00000024294
AA Change: D498N

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 74 5.7e-25 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 221 5.5e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure of heart looping, impaired angiogenesis and arterial specification, premature neuronal precursor differentiation, posterior truncation, and abnormal somitogenesis with loss ofposterior markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Mib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mib1 APN 18 10798490 missense probably benign 0.02
IGL02300:Mib1 APN 18 10741016 missense probably damaging 1.00
IGL02701:Mib1 APN 18 10747357 missense probably damaging 0.98
IGL02731:Mib1 APN 18 10800115 missense possibly damaging 0.81
IGL03002:Mib1 APN 18 10798356 missense possibly damaging 0.87
IGL03083:Mib1 APN 18 10752029 critical splice donor site probably null
PIT4468001:Mib1 UTSW 18 10798463 missense possibly damaging 0.86
R0496:Mib1 UTSW 18 10804773 missense probably benign
R1015:Mib1 UTSW 18 10726409 missense probably damaging 1.00
R1237:Mib1 UTSW 18 10768149 missense probably damaging 1.00
R1557:Mib1 UTSW 18 10798474 missense probably damaging 1.00
R1918:Mib1 UTSW 18 10740972 splice site probably null
R1952:Mib1 UTSW 18 10812077 missense possibly damaging 0.94
R1982:Mib1 UTSW 18 10812064 missense probably damaging 1.00
R2009:Mib1 UTSW 18 10812118 missense probably damaging 1.00
R2372:Mib1 UTSW 18 10812045 missense probably damaging 1.00
R2422:Mib1 UTSW 18 10751906 missense probably damaging 1.00
R2922:Mib1 UTSW 18 10760831 nonsense probably null
R2923:Mib1 UTSW 18 10760831 nonsense probably null
R2938:Mib1 UTSW 18 10752033 splice site probably benign
R3814:Mib1 UTSW 18 10763281 missense probably benign 0.09
R3858:Mib1 UTSW 18 10798409 missense possibly damaging 0.56
R4356:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4357:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4358:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4406:Mib1 UTSW 18 10763289 missense probably damaging 1.00
R4497:Mib1 UTSW 18 10811985 missense possibly damaging 0.75
R4593:Mib1 UTSW 18 10768191 missense possibly damaging 0.89
R4623:Mib1 UTSW 18 10808086 missense probably benign 0.02
R5068:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5069:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5070:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5258:Mib1 UTSW 18 10795856 splice site probably null
R5322:Mib1 UTSW 18 10792975 missense probably damaging 1.00
R5589:Mib1 UTSW 18 10794488 missense probably benign 0.00
R5622:Mib1 UTSW 18 10794503 missense possibly damaging 0.90
R6401:Mib1 UTSW 18 10795802 missense probably benign
R6928:Mib1 UTSW 18 10802282 missense probably benign 0.02
R7242:Mib1 UTSW 18 10741011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCATTGGCTTAGTTCAATATGG -3'
(R):5'- ACCAATGCCTGCTTAGTATACTCC -3'

Sequencing Primer
(F):5'- GTTCAATATGGTGTAATGTGACTAGC -3'
(R):5'- CCTGGAGACTGGGATGACAACC -3'
Posted On2019-06-07