Incidental Mutation 'PIT4466001:Pfkfb4'
ID555791
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108991778-109032228 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108999154 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 86 (Y86H)
Ref Sequence ENSEMBL: ENSMUSP00000142378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
Predicted Effect probably benign
Transcript: ENSMUST00000051873
AA Change: Y70H

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: Y70H

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably benign
Transcript: ENSMUST00000198140
AA Change: Y86H

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: Y86H

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199591
AA Change: Y86H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: Y86H

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108999134 missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 109028942 missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 109030336 missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 109007296 missense probably null 1.00
PIT4472001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 109007701 missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 109010643 missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 109027742 splice site probably benign
R0511:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 109027620 missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 109007305 missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108999169 missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 109005609 missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 109025042 splice site probably benign
R5470:Pfkfb4 UTSW 9 109027593 missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 109008421 missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 109030394 unclassified probably benign
R6139:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 109009562 splice site probably null
R6873:Pfkfb4 UTSW 9 109010335 splice site probably null
R6958:Pfkfb4 UTSW 9 109010547 missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108999154 missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 109007302 missense probably benign 0.21
R7148:Pfkfb4 UTSW 9 109027608 missense probably damaging 0.99
R7284:Pfkfb4 UTSW 9 109011240 missense possibly damaging 0.88
R7903:Pfkfb4 UTSW 9 108998951 missense probably damaging 1.00
R7973:Pfkfb4 UTSW 9 109025111 missense probably damaging 1.00
R8506:Pfkfb4 UTSW 9 109005599 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AACTGGATTGGCGTGCCTAC -3'
(R):5'- TCACTGCACTGAGTAACTGCAG -3'

Sequencing Primer
(F):5'- ATTGGCGTGCCTACTCGGG -3'
(R):5'- GAGAGAGGAGGAACTTCTT -3'
Posted On2019-06-07