Incidental Mutation 'R6982:Kdm4a'
ID557097
Institutional Source Beutler Lab
Gene Symbol Kdm4a
Ensembl Gene ENSMUSG00000033326
Gene Namelysine (K)-specific demethylase 4A
SynonymsJmjd2, D4Ertd222e, JHDM3A, Jmjd2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R6982 (G1)
Quality Score62.0073
Status Validated
Chromosome4
Chromosomal Location118136957-118180043 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 118153439 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050288] [ENSMUST00000097911] [ENSMUST00000106403] [ENSMUST00000106406]
Predicted Effect probably null
Transcript: ENSMUST00000050288
SMART Domains Protein: ENSMUSP00000062910
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.87e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000097911
SMART Domains Protein: ENSMUSP00000095524
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106403
SMART Domains Protein: ENSMUSP00000102011
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106406
SMART Domains Protein: ENSMUSP00000102014
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family and encodes a protein containing a JmjN domain, a JmjC domain, a JD2H domain, two TUDOR domains, and two PHD-type zinc fingers. This nuclear protein functions as a trimethylation-specific demethylase, converting specific trimethylated histone residues to the dimethylated form, and as a transcriptional repressor. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Adamtsl3 C A 7: 82,515,063 P362H probably damaging Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
Bmp8a A G 4: 123,325,141 L158P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Clybl G A 14: 122,401,947 G308R probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Man1a T C 10: 54,074,723 E101G possibly damaging Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Myo3b A T 2: 70,426,065 E1248D probably benign Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Olfr951 T C 9: 39,394,322 I174T probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spata21 A T 4: 141,096,873 N149I possibly damaging Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Spink5 T C 18: 44,010,042 probably null Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tcf3 A T 10: 80,417,550 F215I probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in Kdm4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kdm4a APN 4 118160501 missense probably damaging 1.00
IGL01845:Kdm4a APN 4 118160459 missense possibly damaging 0.85
IGL02009:Kdm4a APN 4 118160169 missense probably benign 0.01
IGL02296:Kdm4a APN 4 118177465 missense probably damaging 1.00
IGL02366:Kdm4a APN 4 118160506 critical splice acceptor site probably null
IGL02606:Kdm4a APN 4 118160289 missense probably benign 0.00
IGL02673:Kdm4a APN 4 118168572 missense probably benign 0.00
R0245:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0326:Kdm4a UTSW 4 118161706 missense probably benign 0.00
R0551:Kdm4a UTSW 4 118138231 makesense probably null
R0603:Kdm4a UTSW 4 118142511 missense probably damaging 1.00
R0652:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0799:Kdm4a UTSW 4 118146992 splice site probably null
R0847:Kdm4a UTSW 4 118164498 missense probably damaging 0.96
R1307:Kdm4a UTSW 4 118175642 missense probably benign 0.02
R1572:Kdm4a UTSW 4 118138949 missense possibly damaging 0.89
R1869:Kdm4a UTSW 4 118138871 missense probably null 1.00
R1902:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R1903:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R2135:Kdm4a UTSW 4 118142459 missense probably damaging 1.00
R3856:Kdm4a UTSW 4 118153231 missense probably damaging 1.00
R4687:Kdm4a UTSW 4 118144083 missense probably damaging 1.00
R4940:Kdm4a UTSW 4 118161754 missense probably benign 0.00
R5115:Kdm4a UTSW 4 118162581 missense possibly damaging 0.75
R5229:Kdm4a UTSW 4 118146605 missense probably damaging 0.99
R5305:Kdm4a UTSW 4 118160501 missense probably damaging 1.00
R5423:Kdm4a UTSW 4 118138908 missense probably damaging 1.00
R5750:Kdm4a UTSW 4 118142199 intron probably benign
R5849:Kdm4a UTSW 4 118161840 missense probably benign 0.17
R5876:Kdm4a UTSW 4 118138876 missense probably damaging 0.98
R6564:Kdm4a UTSW 4 118177439 missense probably benign 0.18
R6772:Kdm4a UTSW 4 118142555 critical splice acceptor site probably null
R7410:Kdm4a UTSW 4 118143918 missense possibly damaging 0.64
R7418:Kdm4a UTSW 4 118160243 missense probably damaging 0.99
Z1176:Kdm4a UTSW 4 118153190 missense probably benign 0.00
Z1176:Kdm4a UTSW 4 118177502 missense probably benign 0.41
Z1177:Kdm4a UTSW 4 118147169 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCTTATTCTCCTCCAGGGAAAG -3'
(R):5'- ATGGCTTCTGCTTTTCTGAGAC -3'

Sequencing Primer
(F):5'- TCCAGGGAAAGCATGTACTCATCTG -3'
(R):5'- ACGTGGCACCAGTATATGTC -3'
Posted On2019-06-19