Incidental Mutation 'R0799:Kdm4a'
ID76518
Institutional Source Beutler Lab
Gene Symbol Kdm4a
Ensembl Gene ENSMUSG00000033326
Gene Namelysine (K)-specific demethylase 4A
SynonymsJmjd2, D4Ertd222e, JHDM3A, Jmjd2a
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R0799 (G1)
Quality Score204
Status Validated
Chromosome4
Chromosomal Location118136957-118180043 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 118146992 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050288] [ENSMUST00000097911] [ENSMUST00000106403] [ENSMUST00000106406]
Predicted Effect probably null
Transcript: ENSMUST00000050288
SMART Domains Protein: ENSMUSP00000062910
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.87e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000097911
SMART Domains Protein: ENSMUSP00000095524
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106403
SMART Domains Protein: ENSMUSP00000102011
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106406
SMART Domains Protein: ENSMUSP00000102014
Gene: ENSMUSG00000033326

DomainStartEndE-ValueType
JmjN 13 55 1.01e-20 SMART
JmjC 142 308 3.57e-63 SMART
low complexity region 461 487 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
PHD 709 767 4.93e-4 SMART
PHD 829 885 1.54e-5 SMART
TUDOR 897 954 2.41e-10 SMART
TUDOR 955 1011 4.77e-14 SMART
low complexity region 1032 1044 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164821
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family and encodes a protein containing a JmjN domain, a JmjC domain, a JD2H domain, two TUDOR domains, and two PHD-type zinc fingers. This nuclear protein functions as a trimethylation-specific demethylase, converting specific trimethylated histone residues to the dimethylated form, and as a transcriptional repressor. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Kdm4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kdm4a APN 4 118160501 missense probably damaging 1.00
IGL01845:Kdm4a APN 4 118160459 missense possibly damaging 0.85
IGL02009:Kdm4a APN 4 118160169 missense probably benign 0.01
IGL02296:Kdm4a APN 4 118177465 missense probably damaging 1.00
IGL02366:Kdm4a APN 4 118160506 critical splice acceptor site probably null
IGL02606:Kdm4a APN 4 118160289 missense probably benign 0.00
IGL02673:Kdm4a APN 4 118168572 missense probably benign 0.00
R0245:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0326:Kdm4a UTSW 4 118161706 missense probably benign 0.00
R0551:Kdm4a UTSW 4 118138231 makesense probably null
R0603:Kdm4a UTSW 4 118142511 missense probably damaging 1.00
R0652:Kdm4a UTSW 4 118175689 missense probably benign 0.05
R0847:Kdm4a UTSW 4 118164498 missense probably damaging 0.96
R1307:Kdm4a UTSW 4 118175642 missense probably benign 0.02
R1572:Kdm4a UTSW 4 118138949 missense possibly damaging 0.89
R1869:Kdm4a UTSW 4 118138871 missense probably null 1.00
R1902:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R1903:Kdm4a UTSW 4 118160399 missense probably benign 0.38
R2135:Kdm4a UTSW 4 118142459 missense probably damaging 1.00
R3856:Kdm4a UTSW 4 118153231 missense probably damaging 1.00
R4687:Kdm4a UTSW 4 118144083 missense probably damaging 1.00
R4940:Kdm4a UTSW 4 118161754 missense probably benign 0.00
R5115:Kdm4a UTSW 4 118162581 missense possibly damaging 0.75
R5229:Kdm4a UTSW 4 118146605 missense probably damaging 0.99
R5305:Kdm4a UTSW 4 118160501 missense probably damaging 1.00
R5423:Kdm4a UTSW 4 118138908 missense probably damaging 1.00
R5750:Kdm4a UTSW 4 118142199 intron probably benign
R5849:Kdm4a UTSW 4 118161840 missense probably benign 0.17
R5876:Kdm4a UTSW 4 118138876 missense probably damaging 0.98
R6564:Kdm4a UTSW 4 118177439 missense probably benign 0.18
R6772:Kdm4a UTSW 4 118142555 critical splice acceptor site probably null
R6982:Kdm4a UTSW 4 118153439 intron probably null
R7410:Kdm4a UTSW 4 118143918 missense possibly damaging 0.64
R7418:Kdm4a UTSW 4 118160243 missense probably damaging 0.99
Z1176:Kdm4a UTSW 4 118153190 missense probably benign 0.00
Z1176:Kdm4a UTSW 4 118177502 missense probably benign 0.41
Z1177:Kdm4a UTSW 4 118147169 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCGTTAGAATGCAGATGCACAG -3'
(R):5'- GGAATTTGGAGCCTTCAGTCAGAGC -3'

Sequencing Primer
(F):5'- ATGCAGATGCACAGTGCTC -3'
(R):5'- CCTTCAGTCAGAGCTGTGGG -3'
Posted On2013-10-16