Incidental Mutation 'R7176:Tbl3'
ID558646
Institutional Source Beutler Lab
Gene Symbol Tbl3
Ensembl Gene ENSMUSG00000040688
Gene Nametransducin (beta)-like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R7176 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24697949-24707660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24700758 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 774 (T774I)
Ref Sequence ENSEMBL: ENSMUSP00000120911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019464] [ENSMUST00000046839] [ENSMUST00000126319]
Predicted Effect probably benign
Transcript: ENSMUST00000019464
SMART Domains Protein: ENSMUSP00000019464
Gene: ENSMUSG00000019320

DomainStartEndE-ValueType
PX 6 122 1.36e-2 SMART
SH3 160 218 1.55e0 SMART
SH3 234 289 1.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046839
SMART Domains Protein: ENSMUSP00000049186
Gene: ENSMUSG00000040888

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Pfam:Evr1_Alr 97 189 2.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126319
AA Change: T774I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120911
Gene: ENSMUSG00000040688
AA Change: T774I

DomainStartEndE-ValueType
WD40 54 94 3.08e0 SMART
WD40 97 137 2.38e-6 SMART
WD40 140 181 3.85e-1 SMART
WD40 184 223 6.94e-8 SMART
WD40 237 275 7.36e1 SMART
WD40 278 320 3.07e1 SMART
WD40 323 363 1.78e0 SMART
WD40 365 404 1.17e-5 SMART
WD40 410 450 8.16e-5 SMART
WD40 468 507 5.18e-7 SMART
WD40 510 549 8.1e-9 SMART
WD40 552 591 8.55e-8 SMART
WD40 594 633 2.93e-6 SMART
low complexity region 637 650 N/A INTRINSIC
Pfam:Utp13 654 788 3.7e-43 PFAM
low complexity region 792 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130633
SMART Domains Protein: ENSMUSP00000117818
Gene: ENSMUSG00000040688

DomainStartEndE-ValueType
WD40 2 38 8.75e-5 SMART
WD40 41 80 8.1e-9 SMART
WD40 90 129 9.52e-6 SMART
WD40 132 171 2.93e-6 SMART
low complexity region 175 188 N/A INTRINSIC
Pfam:Utp13 192 299 1e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene has multiple polyadenylation sites. It might have multiple alternatively spliced transcript variants but the variants have not been fully described yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,277 H267N probably benign Het
Abtb2 A G 2: 103,709,375 D695G probably benign Het
Adam21 C T 12: 81,560,248 D247N possibly damaging Het
Adnp T C 2: 168,182,658 N906D probably benign Het
Ankrd17 A T 5: 90,268,735 H1079Q probably damaging Het
Aqp3 T A 4: 41,095,202 N60Y probably damaging Het
Art4 T G 6: 136,857,168 T26P probably benign Het
Arvcf T C 16: 18,399,727 L553P probably damaging Het
Asxl1 T A 2: 153,401,988 I1487N probably damaging Het
Capn3 A T 2: 120,504,492 Y820F possibly damaging Het
Catip A G 1: 74,362,782 T39A probably damaging Het
Ccdc18 T A 5: 108,168,106 C481S probably benign Het
Ccnf A G 17: 24,249,402 I7T possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdkl4 A T 17: 80,543,792 Y160* probably null Het
Celsr3 C T 9: 108,845,762 P2783S probably benign Het
Cisd3 A T 11: 97,686,133 D11V probably benign Het
Daxx A T 17: 33,913,318 H512L unknown Het
Dip2b A G 15: 100,169,318 H567R probably damaging Het
Dnah7c C A 1: 46,430,809 A18E probably benign Het
Eif3d A T 15: 77,963,234 V268D probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Fmnl2 A G 2: 53,114,150 M625V unknown Het
Foxn1 T C 11: 78,360,867 R513G possibly damaging Het
Gemin5 C T 11: 58,166,002 V134I probably benign Het
Gm8251 A T 1: 44,060,346 S531T probably benign Het
Gtf2h3 A G 5: 124,590,370 R161G probably damaging Het
Ice1 A G 13: 70,624,406 probably null Het
Il1rl1 T C 1: 40,446,606 Y306H probably damaging Het
Kbtbd7 A T 14: 79,427,754 E342V possibly damaging Het
Kyat3 A T 3: 142,737,839 K404N possibly damaging Het
Lins1 T C 7: 66,713,805 W483R probably benign Het
Lipo2 A G 19: 33,745,807 I194T possibly damaging Het
Mcm8 G T 2: 132,820,072 A137S probably benign Het
Mdm1 C A 10: 118,142,865 Q12K probably damaging Het
Mrgprb5 C A 7: 48,168,311 L225F possibly damaging Het
Myh11 T A 16: 14,215,826 H1068L Het
Ngef A T 1: 87,480,695 V550E possibly damaging Het
Nrg1 G A 8: 31,968,036 Q84* probably null Het
Obp2b G T 2: 25,737,748 V59L possibly damaging Het
Ocln C A 13: 100,515,082 G327C probably damaging Het
Ocln A C 13: 100,515,083 N326K probably benign Het
Olfr1117-ps1 C T 2: 87,285,034 A248V probably damaging Het
Otogl T C 10: 107,778,911 D1960G probably damaging Het
Pik3c2a T C 7: 116,388,096 D530G possibly damaging Het
Plod1 A T 4: 147,913,287 M655K probably benign Het
Ppp4r3b A G 11: 29,198,904 N449D probably damaging Het
Ppp6r3 G T 19: 3,471,989 T563K probably damaging Het
Prepl T A 17: 85,069,026 L533F probably benign Het
Rbl1 G A 2: 157,188,325 R421W probably damaging Het
Rrp15 G A 1: 186,721,533 S239L probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 A G 5: 124,392,881 S815P probably benign Het
Scn7a G A 2: 66,676,288 T1419I probably damaging Het
Setdb1 A G 3: 95,337,147 probably null Het
Shpk A G 11: 73,222,988 H409R probably benign Het
Slamf6 A C 1: 171,934,291 N93T probably benign Het
Slc27a4 A G 2: 29,811,226 N343S probably benign Het
Slc35g1 T A 19: 38,403,323 V351E probably damaging Het
Smcr8 A T 11: 60,778,946 I307F probably damaging Het
Spats2l T C 1: 57,937,918 I305T possibly damaging Het
Speer4c T C 5: 15,711,538 T144A probably benign Het
Ush2a A G 1: 188,537,728 H1724R probably benign Het
Vcan A G 13: 89,688,936 S2830P probably benign Het
Vmn2r27 T A 6: 124,192,036 I712F probably benign Het
Wdr59 T G 8: 111,492,756 Q223P Het
Zfp28 T A 7: 6,383,457 C22S possibly damaging Het
Zfp536 T G 7: 37,480,851 probably null Het
Other mutations in Tbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Tbl3 APN 17 24701905 splice site probably benign
IGL01092:Tbl3 APN 17 24705252 missense probably damaging 1.00
IGL01601:Tbl3 APN 17 24702317 missense probably damaging 1.00
IGL01610:Tbl3 APN 17 24704044 missense probably damaging 1.00
IGL02214:Tbl3 APN 17 24704132 unclassified probably benign
IGL03027:Tbl3 APN 17 24701193 critical splice acceptor site probably null
FR4449:Tbl3 UTSW 17 24702544 unclassified probably benign
R0230:Tbl3 UTSW 17 24701333 missense probably damaging 1.00
R0288:Tbl3 UTSW 17 24701807 missense probably damaging 1.00
R0305:Tbl3 UTSW 17 24705461 missense probably damaging 1.00
R1104:Tbl3 UTSW 17 24701606 missense probably benign 0.02
R1920:Tbl3 UTSW 17 24704503 missense probably benign 0.04
R2513:Tbl3 UTSW 17 24704550 critical splice acceptor site probably null
R2570:Tbl3 UTSW 17 24703316 missense possibly damaging 0.47
R2851:Tbl3 UTSW 17 24702583 missense probably damaging 1.00
R3905:Tbl3 UTSW 17 24702032 missense probably damaging 1.00
R3944:Tbl3 UTSW 17 24700708 missense possibly damaging 0.94
R4019:Tbl3 UTSW 17 24704721 missense probably damaging 0.98
R4745:Tbl3 UTSW 17 24705330 unclassified probably benign
R5288:Tbl3 UTSW 17 24705970 missense possibly damaging 0.88
R5605:Tbl3 UTSW 17 24700759 missense probably benign 0.06
R5791:Tbl3 UTSW 17 24704434 missense probably damaging 0.99
R6236:Tbl3 UTSW 17 24700743 missense probably benign 0.12
R6302:Tbl3 UTSW 17 24704671 missense probably benign 0.05
R6938:Tbl3 UTSW 17 24705213 missense possibly damaging 0.61
R7173:Tbl3 UTSW 17 24705259 missense probably benign
R7382:Tbl3 UTSW 17 24705291 missense probably benign 0.21
R7555:Tbl3 UTSW 17 24701976 critical splice donor site probably null
R7732:Tbl3 UTSW 17 24704162 missense probably benign 0.00
R7780:Tbl3 UTSW 17 24702231 missense probably damaging 1.00
R7899:Tbl3 UTSW 17 24702484 missense probably damaging 1.00
R8108:Tbl3 UTSW 17 24700916 missense probably benign
RF005:Tbl3 UTSW 17 24702541 unclassified probably benign
X0022:Tbl3 UTSW 17 24705573 nonsense probably null
X0028:Tbl3 UTSW 17 24702321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCTAGAGATGACGCCTCG -3'
(R):5'- TCCAGACATTGCCACGAAGC -3'

Sequencing Primer
(F):5'- TAGAGATGACGCCTCGGTCAG -3'
(R):5'- ATTGCCACGAAGCCCAGG -3'
Posted On2019-06-26