Incidental Mutation 'R7780:Tbl3'
ID599200
Institutional Source Beutler Lab
Gene Symbol Tbl3
Ensembl Gene ENSMUSG00000040688
Gene Nametransducin (beta)-like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R7780 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24697949-24707660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24702231 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 529 (F529L)
Ref Sequence ENSEMBL: ENSMUSP00000120911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019464] [ENSMUST00000126319]
Predicted Effect probably benign
Transcript: ENSMUST00000019464
SMART Domains Protein: ENSMUSP00000019464
Gene: ENSMUSG00000019320

DomainStartEndE-ValueType
PX 6 122 1.36e-2 SMART
SH3 160 218 1.55e0 SMART
SH3 234 289 1.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126319
AA Change: F529L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120911
Gene: ENSMUSG00000040688
AA Change: F529L

DomainStartEndE-ValueType
WD40 54 94 3.08e0 SMART
WD40 97 137 2.38e-6 SMART
WD40 140 181 3.85e-1 SMART
WD40 184 223 6.94e-8 SMART
WD40 237 275 7.36e1 SMART
WD40 278 320 3.07e1 SMART
WD40 323 363 1.78e0 SMART
WD40 365 404 1.17e-5 SMART
WD40 410 450 8.16e-5 SMART
WD40 468 507 5.18e-7 SMART
WD40 510 549 8.1e-9 SMART
WD40 552 591 8.55e-8 SMART
WD40 594 633 2.93e-6 SMART
low complexity region 637 650 N/A INTRINSIC
Pfam:Utp13 654 788 3.7e-43 PFAM
low complexity region 792 800 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117818
Gene: ENSMUSG00000040688
AA Change: F59L

DomainStartEndE-ValueType
WD40 2 38 8.75e-5 SMART
WD40 41 80 8.1e-9 SMART
WD40 90 129 9.52e-6 SMART
WD40 132 171 2.93e-6 SMART
low complexity region 175 188 N/A INTRINSIC
Pfam:Utp13 192 299 1e-30 PFAM
Meta Mutation Damage Score 0.7665 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene has multiple polyadenylation sites. It might have multiple alternatively spliced transcript variants but the variants have not been fully described yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,372 S495P probably damaging Het
Adam5 C T 8: 24,804,416 R389K possibly damaging Het
Ahnak2 C T 12: 112,782,613 V1205M Het
C330027C09Rik T A 16: 49,001,660 L217* probably null Het
Ccr3 A G 9: 124,028,952 Y108C probably benign Het
Cers5 T G 15: 99,739,708 H220P probably damaging Het
Cfap61 A T 2: 146,153,772 N1086Y possibly damaging Het
Clstn3 T C 6: 124,462,202 E32G probably damaging Het
Cox20 T C 1: 178,322,001 C72R probably benign Het
Csf1 A T 3: 107,750,393 N154K probably damaging Het
Cyp2j7 T A 4: 96,230,019 K112N probably benign Het
Dpcr1 A G 17: 35,636,982 S452P possibly damaging Het
Drosha A G 15: 12,848,086 D488G probably benign Het
Edem1 A G 6: 108,841,628 K199R probably benign Het
Esyt2 T C 12: 116,342,098 I316T probably benign Het
Evpl C T 11: 116,234,174 R154H not run Het
Fam198b G A 3: 79,941,404 G486S probably damaging Het
Fbn1 A G 2: 125,301,758 L2817P probably benign Het
Fbxo42 T A 4: 141,193,820 probably null Het
Fbxo43 T C 15: 36,162,212 D283G probably damaging Het
Fdxr A T 11: 115,276,830 S20T probably benign Het
Fkbp10 T C 11: 100,421,222 Y203H probably damaging Het
Galntl6 C T 8: 58,427,699 probably null Het
Gm26657 C A 4: 56,741,056 Y80* probably null Het
Gm973 T A 1: 59,558,130 W440R probably damaging Het
Helz T A 11: 107,637,863 F903Y probably damaging Het
Iqcf4 T A 9: 106,568,661 I96F possibly damaging Het
Kcnq5 T A 1: 21,961,331 Q84L probably benign Het
Krit1 G A 5: 3,812,772 G254S probably damaging Het
Krtap6-2 A T 16: 89,419,622 Y152* probably null Het
Lor A T 3: 92,081,153 Y275* probably null Het
Map4 T C 9: 110,034,652 I315T probably benign Het
Mcpt1 T A 14: 56,019,152 probably null Het
Mdh1b C A 1: 63,719,974 S153I possibly damaging Het
Mfsd12 C A 10: 81,357,884 A96E probably benign Het
Mki67 T C 7: 135,713,968 E55G probably benign Het
Mterf4 T C 1: 93,304,967 E54G probably benign Het
Nuggc T A 14: 65,645,041 I745N probably damaging Het
Olfr231 T C 1: 174,117,549 I156V probably benign Het
Olfr830 A G 9: 18,875,614 T93A possibly damaging Het
Parg A T 14: 32,208,801 N126I possibly damaging Het
Pcdh9 T C 14: 93,886,551 I728V possibly damaging Het
Pcdha1 C G 18: 36,932,458 P725R probably benign Het
Pcdha11 T A 18: 37,012,796 L647M probably damaging Het
Phb2 T C 6: 124,716,032 probably null Het
Plb1 A G 5: 32,326,266 probably null Het
Pmch T A 10: 88,091,251 F39I probably benign Het
Psmd7 A T 8: 107,581,288 S188T possibly damaging Het
Pycr2 T A 1: 180,906,348 D168E probably damaging Het
Rab43 A G 6: 87,794,710 Y96H probably damaging Het
Ralgapa2 C T 2: 146,342,414 G1511S probably benign Het
Rb1cc1 T A 1: 6,248,914 C852* probably null Het
Rexo2 T C 9: 48,468,845 N229S probably damaging Het
Sema4f A G 6: 82,913,960 V622A possibly damaging Het
Serpina10 T C 12: 103,628,547 S138G probably benign Het
Sptbn4 T A 7: 27,361,634 T2415S possibly damaging Het
Tbc1d22b A G 17: 29,573,066 N257D probably benign Het
Them6 A T 15: 74,721,578 N95I probably benign Het
Thrb T C 14: 18,008,608 S156P possibly damaging Het
Tmem186 G A 16: 8,635,867 R177C probably benign Het
Ttn T A 2: 76,830,593 probably null Het
Unc13a T A 8: 71,658,335 I411F probably benign Het
Uqcc1 T C 2: 155,910,153 probably null Het
Vmn1r56 T C 7: 5,196,517 T34A possibly damaging Het
Vps39 A T 2: 120,325,199 Y542* probably null Het
Wdr64 T C 1: 175,728,976 L263P probably damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Wfdc16 A G 2: 164,635,865 M88T probably benign Het
Wnk4 A G 11: 101,269,577 D679G probably damaging Het
Ykt6 T C 11: 5,962,751 I151T probably benign Het
Zbtb46 A G 2: 181,391,432 C479R probably damaging Het
Zc3h7a A G 16: 11,149,251 I559T probably benign Het
Zfhx3 A G 8: 108,951,651 N3111S possibly damaging Het
Zfp619 T C 7: 39,535,008 V154A possibly damaging Het
Zfp629 A T 7: 127,612,429 D69E probably benign Het
Zfp882 T A 8: 71,914,229 I300N possibly damaging Het
Zfp934 T C 13: 62,518,544 H106R possibly damaging Het
Zfyve9 G A 4: 108,719,101 T261I possibly damaging Het
Other mutations in Tbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Tbl3 APN 17 24701905 splice site probably benign
IGL01092:Tbl3 APN 17 24705252 missense probably damaging 1.00
IGL01601:Tbl3 APN 17 24702317 missense probably damaging 1.00
IGL01610:Tbl3 APN 17 24704044 missense probably damaging 1.00
IGL02214:Tbl3 APN 17 24704132 unclassified probably benign
IGL03027:Tbl3 APN 17 24701193 critical splice acceptor site probably null
FR4449:Tbl3 UTSW 17 24702544 unclassified probably benign
R0230:Tbl3 UTSW 17 24701333 missense probably damaging 1.00
R0288:Tbl3 UTSW 17 24701807 missense probably damaging 1.00
R0305:Tbl3 UTSW 17 24705461 missense probably damaging 1.00
R1104:Tbl3 UTSW 17 24701606 missense probably benign 0.02
R1920:Tbl3 UTSW 17 24704503 missense probably benign 0.04
R2513:Tbl3 UTSW 17 24704550 critical splice acceptor site probably null
R2570:Tbl3 UTSW 17 24703316 missense possibly damaging 0.47
R2851:Tbl3 UTSW 17 24702583 missense probably damaging 1.00
R3905:Tbl3 UTSW 17 24702032 missense probably damaging 1.00
R3944:Tbl3 UTSW 17 24700708 missense possibly damaging 0.94
R4019:Tbl3 UTSW 17 24704721 missense probably damaging 0.98
R4745:Tbl3 UTSW 17 24705330 unclassified probably benign
R5288:Tbl3 UTSW 17 24705970 missense possibly damaging 0.88
R5605:Tbl3 UTSW 17 24700759 missense probably benign 0.06
R5791:Tbl3 UTSW 17 24704434 missense probably damaging 0.99
R6236:Tbl3 UTSW 17 24700743 missense probably benign 0.12
R6302:Tbl3 UTSW 17 24704671 missense probably benign 0.05
R6938:Tbl3 UTSW 17 24705213 missense possibly damaging 0.61
R7173:Tbl3 UTSW 17 24705259 missense probably benign
R7176:Tbl3 UTSW 17 24700758 missense probably benign 0.01
R7382:Tbl3 UTSW 17 24705291 missense probably benign 0.21
R7555:Tbl3 UTSW 17 24701976 critical splice donor site probably null
R7732:Tbl3 UTSW 17 24704162 missense probably benign 0.00
R7899:Tbl3 UTSW 17 24702484 missense probably damaging 1.00
R8108:Tbl3 UTSW 17 24700916 missense probably benign
RF005:Tbl3 UTSW 17 24702541 unclassified probably benign
X0022:Tbl3 UTSW 17 24705573 nonsense probably null
X0028:Tbl3 UTSW 17 24702321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAAATGTCTGCAGGGAGAG -3'
(R):5'- TGCCACGACAAAGTAGCCAG -3'

Sequencing Primer
(F):5'- TGTCTGCAGGGAGAGACAGAG -3'
(R):5'- CATACATGGCCTCTGGGGTG -3'
Posted On2019-11-26