Incidental Mutation 'R7177:Nxph1'
ID558673
Institutional Source Beutler Lab
Gene Symbol Nxph1
Ensembl Gene ENSMUSG00000046178
Gene Nameneurexophilin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location8948431-9249032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9247497 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 156 (N156S)
Ref Sequence ENSEMBL: ENSMUSP00000060926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060369] [ENSMUST00000160300]
Predicted Effect probably damaging
Transcript: ENSMUST00000060369
AA Change: N156S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060926
Gene: ENSMUSG00000046178
AA Change: N156S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
Pfam:Neurexophilin 63 271 1.2e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160300
AA Change: N156S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125274
Gene: ENSMUSG00000046178
AA Change: N156S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
Pfam:Neurexophilin 61 271 2.5e-115 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neurexophilin family and encodes a secreted protein with a variable N-terminal domain, a highly conserved, N-glycosylated central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation show no obvious morbidity, premature mortality, or anatomical defects. However, males exhibit sterility and testis abnormalities probably because homologous recombination results in co-insertion of the 5' part of the HSV-TK cassette into the targeted locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Nxph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Nxph1 APN 6 9247743 missense probably damaging 1.00
IGL02256:Nxph1 APN 6 9247185 missense probably benign 0.13
IGL03229:Nxph1 APN 6 9247830 missense probably damaging 1.00
R0305:Nxph1 UTSW 6 9247754 missense probably damaging 1.00
R1722:Nxph1 UTSW 6 9247516 missense probably damaging 1.00
R1899:Nxph1 UTSW 6 9247622 missense probably damaging 1.00
R2122:Nxph1 UTSW 6 9247791 missense probably damaging 1.00
R2274:Nxph1 UTSW 6 9247746 missense probably damaging 1.00
R5219:Nxph1 UTSW 6 9247765 nonsense probably null
R5715:Nxph1 UTSW 6 9247740 missense probably damaging 1.00
R6048:Nxph1 UTSW 6 9247103 missense probably benign
X0017:Nxph1 UTSW 6 9247208 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACAGATCTTCAGGAGCC -3'
(R):5'- ACGTGACTTTGGGTCTGCTC -3'

Sequencing Primer
(F):5'- AGATCTTCAGGAGCCTCGGC -3'
(R):5'- ACTTTGGGTCTGCTCCTGGTAAC -3'
Posted On2019-06-26