Incidental Mutation 'R7177:Papola'
ID558713
Institutional Source Beutler Lab
Gene Symbol Papola
Ensembl Gene ENSMUSG00000021111
Gene Namepoly (A) polymerase alpha
SynonymsPapIII, Plap
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location105784694-105838944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105809531 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 235 (N235K)
Ref Sequence ENSEMBL: ENSMUSP00000105527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021535] [ENSMUST00000109901] [ENSMUST00000163473] [ENSMUST00000164326] [ENSMUST00000166329] [ENSMUST00000166735] [ENSMUST00000168186] [ENSMUST00000169938] [ENSMUST00000170002] [ENSMUST00000170540]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021535
AA Change: N235K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021535
Gene: ENSMUSG00000021111
AA Change: N235K

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.5e-111 PFAM
Pfam:NTP_transf_2 75 175 2.4e-11 PFAM
Pfam:PAP_RNA-bind 366 508 8.9e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109901
AA Change: N235K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105527
Gene: ENSMUSG00000021111
AA Change: N235K

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:PAP_central 21 364 4.1e-120 PFAM
Pfam:NTP_transf_2 82 175 8.1e-16 PFAM
Pfam:PAP_RNA-bind 366 435 4.1e-21 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163473
AA Change: N235K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131668
Gene: ENSMUSG00000021111
AA Change: N235K

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 9.2e-112 PFAM
Pfam:NTP_transf_2 75 175 3.3e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.6e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164326
SMART Domains Protein: ENSMUSP00000125818
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 64 9.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164798
SMART Domains Protein: ENSMUSP00000125898
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 36 5.3e-8 PFAM
Pfam:PAP_RNA-bind 38 106 8.5e-22 PFAM
low complexity region 190 206 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166329
SMART Domains Protein: ENSMUSP00000131725
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 99 4.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166471
SMART Domains Protein: ENSMUSP00000132353
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 53 9.5e-21 PFAM
Pfam:PAP_RNA-bind 55 123 1.3e-21 PFAM
low complexity region 207 223 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166735
AA Change: N235K

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128908
Gene: ENSMUSG00000021111
AA Change: N235K

DomainStartEndE-ValueType
Pfam:PAP_central 17 283 9.4e-73 PFAM
Pfam:NTP_transf_2 72 175 5.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168186
AA Change: N235K

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128402
Gene: ENSMUSG00000021111
AA Change: N235K

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.6e-11 PFAM
Pfam:PAP_RNA-bind 366 508 5e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
low complexity region 698 712 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000130798
Gene: ENSMUSG00000021111
AA Change: N50K

DomainStartEndE-ValueType
Pfam:PAP_central 1 95 5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169938
SMART Domains Protein: ENSMUSP00000130687
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 157 4.5e-17 PFAM
Pfam:NTP_transf_2 74 166 2.3e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170002
AA Change: N235K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126275
Gene: ENSMUSG00000021111
AA Change: N235K

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.5e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.8e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170540
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the poly(A) polymerase family. It is required for the addition of adenosine residues for the creation of the 3'-poly(A) tail of mRNAs. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Papola
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Papola APN 12 105809597 nonsense probably null
IGL02197:Papola APN 12 105829183 missense possibly damaging 0.90
IGL02511:Papola APN 12 105809345 missense probably damaging 0.99
IGL02608:Papola APN 12 105809559 missense probably damaging 1.00
IGL03081:Papola APN 12 105818855 missense probably damaging 1.00
IGL03378:Papola APN 12 105809433 critical splice donor site probably null
IGL03401:Papola APN 12 105829122 missense probably benign 0.19
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0325:Papola UTSW 12 105807193 missense probably damaging 1.00
R0372:Papola UTSW 12 105818838 missense probably benign 0.05
R1553:Papola UTSW 12 105820410 missense probably benign 0.30
R1746:Papola UTSW 12 105807209 missense probably benign 0.12
R1954:Papola UTSW 12 105828273 unclassified probably null
R2424:Papola UTSW 12 105827052 missense probably benign 0.02
R4133:Papola UTSW 12 105799658 missense possibly damaging 0.83
R4156:Papola UTSW 12 105800751 critical splice donor site probably null
R4718:Papola UTSW 12 105820448 missense possibly damaging 0.72
R4814:Papola UTSW 12 105799653 missense probably damaging 1.00
R5115:Papola UTSW 12 105826960 missense probably benign 0.08
R5237:Papola UTSW 12 105826960 missense probably benign 0.08
R5372:Papola UTSW 12 105827050 missense probably benign 0.00
R5420:Papola UTSW 12 105806495 missense possibly damaging 0.95
R5430:Papola UTSW 12 105809584 missense probably damaging 1.00
R5831:Papola UTSW 12 105823600 missense probably benign 0.01
R5944:Papola UTSW 12 105812385 missense possibly damaging 0.87
R5956:Papola UTSW 12 105811041 missense probably damaging 1.00
R6143:Papola UTSW 12 105826960 missense probably benign 0.08
R6193:Papola UTSW 12 105820346 missense probably benign 0.42
R6413:Papola UTSW 12 105806504 start gained probably benign
R6490:Papola UTSW 12 105804937 missense probably benign 0.40
R6649:Papola UTSW 12 105812307 missense possibly damaging 0.72
R6891:Papola UTSW 12 105809691 unclassified probably benign
R7147:Papola UTSW 12 105808638 start gained probably benign
R7178:Papola UTSW 12 105807184 missense probably damaging 1.00
R7256:Papola UTSW 12 105809345 missense probably damaging 0.99
R7583:Papola UTSW 12 105811045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATTAATCAGGTTGCAGGG -3'
(R):5'- AACCAGCTGTAGAAATGTCACAG -3'

Sequencing Primer
(F):5'- CATCAAACTGTGGGCCAA -3'
(R):5'- AAGACTAAACTTCAGTGTCTACAATC -3'
Posted On2019-06-26