Incidental Mutation 'R7247:Gpr156'
ID563643
Institutional Source Beutler Lab
Gene Symbol Gpr156
Ensembl Gene ENSMUSG00000046961
Gene NameG protein-coupled receptor 156
SynonymsGababl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7247 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location37916496-38007530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37947741 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 6 (N6K)
Ref Sequence ENSEMBL: ENSMUSP00000055958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061274]
Predicted Effect probably damaging
Transcript: ENSMUST00000061274
AA Change: N6K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055958
Gene: ENSMUSG00000046961
AA Change: N6K

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:7tm_3 61 313 2.6e-37 PFAM
coiled coil region 353 390 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
low complexity region 681 716 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G protein-coupled receptors (GPCRs) are a large superfamily of cell surface receptors characterized by 7 helical transmembrane domains, together with N-terminal extracellular and C-terminal intracellular domains.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A T 8: 105,284,699 Y268N probably benign Het
Abca13 A G 11: 9,290,732 E865G probably benign Het
Actrt2 A C 4: 154,667,423 D85E probably benign Het
Ankrd55 A G 13: 112,336,253 E153G probably damaging Het
Arfgef3 T A 10: 18,625,391 H1037L probably benign Het
Camk2a A G 18: 60,943,205 Y85C unknown Het
Caprin1 A T 2: 103,779,474 V153E possibly damaging Het
Caskin2 G A 11: 115,801,896 P688S probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ccdc116 T C 16: 17,139,691 T535A possibly damaging Het
Cdh9 G A 15: 16,778,255 R52H probably damaging Het
Cdk5rap2 A G 4: 70,337,429 L406S probably damaging Het
Cep350 A G 1: 155,910,753 M1449T probably damaging Het
Chst8 T A 7: 34,675,936 K159N probably damaging Het
Dcdc2a A G 13: 25,102,391 H136R probably benign Het
Dip2a C T 10: 76,272,532 probably null Het
Dock2 G A 11: 34,714,513 R260* probably null Het
Dscam A G 16: 96,820,808 V481A probably damaging Het
E130308A19Rik A G 4: 59,690,502 D112G probably damaging Het
Ezh2 T C 6: 47,533,774 K634E probably damaging Het
Fcgr2b A G 1: 170,965,700 probably null Het
Fgfrl1 T C 5: 108,703,499 V94A possibly damaging Het
Gm31371 A G 8: 19,903,421 N10S Het
Gsdmc2 A T 15: 63,833,334 F177I probably benign Het
Igkv4-54 T A 6: 69,631,858 S26C probably damaging Het
Iglc3 T C 16: 19,065,441 H80R Het
Immp1l G A 2: 105,937,056 G87S probably damaging Het
Itgav A T 2: 83,724,835 D34V probably damaging Het
Lrp1b G A 2: 41,269,212 T1686I Het
Ltn1 T C 16: 87,409,387 D935G probably benign Het
Map3k8 T C 18: 4,334,036 D352G probably damaging Het
Map3k9 T C 12: 81,725,830 K610E possibly damaging Het
March4 G T 1: 72,452,478 Y211* probably null Het
Marf1 A T 16: 14,127,093 L1304Q probably damaging Het
Mecom A G 3: 30,140,356 V5A unknown Het
Mep1a A T 17: 43,475,104 V711D possibly damaging Het
Naca T A 10: 128,042,598 D1166E unknown Het
Neb G T 2: 52,258,741 P2598Q probably damaging Het
Notch4 A T 17: 34,572,517 E546V probably damaging Het
Nudt18 A G 14: 70,577,982 T12A unknown Het
Nvl A C 1: 181,112,286 probably null Het
Obscn G T 11: 59,103,318 C1579* probably null Het
Olfr142 G A 2: 90,252,821 P56S probably damaging Het
Olfr27 T A 9: 39,144,857 Y252* probably null Het
Olfr78 T C 7: 102,742,344 I220V probably damaging Het
Olfr785 T C 10: 129,410,182 V272A probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Paqr9 A G 9: 95,560,193 T79A possibly damaging Het
Plec A T 15: 76,177,343 V2798E probably damaging Het
Ptpn4 A T 1: 119,690,034 *557R probably null Het
Ptprt T C 2: 161,533,523 E1379G probably benign Het
Rad18 G T 6: 112,665,325 T327K possibly damaging Het
Rps2 T A 17: 24,720,580 I75N possibly damaging Het
Scgb2b2 A T 7: 31,303,596 R39W probably damaging Het
Sh3d21 A G 4: 126,152,115 F307S probably benign Het
Snap91 A G 9: 86,792,616 V507A unknown Het
Srgap1 T A 10: 121,869,790 Y243F probably damaging Het
Stim1 T A 7: 102,421,532 probably null Het
Top2b T C 14: 16,416,962 V1161A probably benign Het
Tpcn1 T C 5: 120,585,250 D16G possibly damaging Het
Trank1 A T 9: 111,367,512 I1535F probably damaging Het
Txnrd2 T C 16: 18,456,072 F278L probably damaging Het
Ufl1 A T 4: 25,254,637 D579E probably damaging Het
Vps45 T C 3: 96,041,405 N346S probably benign Het
Vps51 T A 19: 6,077,389 probably benign Het
Zfp536 T C 7: 37,569,206 N262D probably benign Het
Zmynd10 A G 9: 107,548,777 I103M possibly damaging Het
Zswim1 C T 2: 164,825,799 H324Y possibly damaging Het
Zxdc T C 6: 90,384,173 W507R unknown Het
Other mutations in Gpr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Gpr156 APN 16 37988576 missense probably damaging 1.00
IGL01615:Gpr156 APN 16 37988591 missense probably damaging 1.00
IGL01976:Gpr156 APN 16 37979033 missense probably damaging 0.97
IGL02217:Gpr156 APN 16 38005311 missense probably benign 0.19
IGL02515:Gpr156 APN 16 38005679 missense probably damaging 0.97
IGL02596:Gpr156 APN 16 37978724 missense probably benign 0.00
IGL03068:Gpr156 APN 16 37992129 missense probably damaging 0.99
R0690:Gpr156 UTSW 16 37992141 missense probably damaging 1.00
R1034:Gpr156 UTSW 16 38004726 missense probably benign
R1133:Gpr156 UTSW 16 38005321 missense probably benign 0.10
R1317:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1437:Gpr156 UTSW 16 37988542 missense probably damaging 0.99
R1484:Gpr156 UTSW 16 37992196 missense probably damaging 0.99
R1759:Gpr156 UTSW 16 37948221 missense probably damaging 0.96
R1761:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1998:Gpr156 UTSW 16 37997908 missense possibly damaging 0.57
R2067:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2111:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2509:Gpr156 UTSW 16 37947787 missense probably benign 0.04
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R3839:Gpr156 UTSW 16 37988600 missense probably damaging 0.99
R4492:Gpr156 UTSW 16 37992106 missense probably damaging 0.99
R4988:Gpr156 UTSW 16 37948215 missense possibly damaging 0.71
R5329:Gpr156 UTSW 16 38005448 missense probably benign 0.00
R5361:Gpr156 UTSW 16 38005725 missense probably damaging 0.99
R5386:Gpr156 UTSW 16 37948309 missense possibly damaging 0.93
R5531:Gpr156 UTSW 16 38005257 missense probably benign 0.01
R5886:Gpr156 UTSW 16 37979013 missense probably damaging 1.00
R5942:Gpr156 UTSW 16 38004902 missense probably benign 0.04
R6345:Gpr156 UTSW 16 37987519 missense probably damaging 1.00
R7353:Gpr156 UTSW 16 37992161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTCTACTTGGAGCCATTTG -3'
(R):5'- AAGTAGGGCCATGCTTGTG -3'

Sequencing Primer
(F):5'- TTCTGTGCTTCAGCGAAC -3'
(R):5'- GCCATGCTTGTGCTACATGGAC -3'
Posted On2019-06-26