Incidental Mutation 'R7289:Pttg1'
ID566255
Institutional Source Beutler Lab
Gene Symbol Pttg1
Ensembl Gene ENSMUSG00000020415
Gene Namepituitary tumor-transforming gene 1
SynonymsPTTG, securin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7289 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location43420250-43426251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43421089 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 180 (N180D)
Ref Sequence ENSEMBL: ENSMUSP00000112841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020685] [ENSMUST00000020687] [ENSMUST00000101340] [ENSMUST00000117446] [ENSMUST00000118368] [ENSMUST00000121638] [ENSMUST00000140434] [ENSMUST00000152115]
Predicted Effect probably benign
Transcript: ENSMUST00000020685
AA Change: N180D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020685
Gene: ENSMUSG00000020415
AA Change: N180D

DomainStartEndE-ValueType
Pfam:Securin 1 186 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020687
SMART Domains Protein: ENSMUSP00000020687
Gene: ENSMUSG00000020415

DomainStartEndE-ValueType
Pfam:Securin 1 184 1.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101340
SMART Domains Protein: ENSMUSP00000098894
Gene: ENSMUSG00000020415

DomainStartEndE-ValueType
Pfam:Securin 1 181 3.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117446
AA Change: N180D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112841
Gene: ENSMUSG00000020415
AA Change: N180D

DomainStartEndE-ValueType
Pfam:Securin 1 186 1.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118368
SMART Domains Protein: ENSMUSP00000112834
Gene: ENSMUSG00000020415

DomainStartEndE-ValueType
Pfam:Securin 1 181 3.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121638
SMART Domains Protein: ENSMUSP00000112815
Gene: ENSMUSG00000020415

DomainStartEndE-ValueType
Pfam:Securin 1 181 3.1e-41 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000140434
AA Change: N91D
SMART Domains Protein: ENSMUSP00000122019
Gene: ENSMUSG00000020415
AA Change: N91D

DomainStartEndE-ValueType
Pfam:Securin 1 97 1.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152115
SMART Domains Protein: ENSMUSP00000119554
Gene: ENSMUSG00000020415

DomainStartEndE-ValueType
Pfam:Securin 1 122 1.7e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show testicular and splenic hypoplasia, thymic hyperplasia, thrombocytopenia, aberrant cell cycle progression, chromosome instability, premature centromere division, reduced female fertility, reduced pancreatic betacell mass and sexually-dimorphic diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,379 T571S probably benign Het
1700022I11Rik A T 4: 42,973,252 I862F possibly damaging Het
4930563D23Rik T C 16: 92,320,822 I193V probably damaging Het
Aars2 G A 17: 45,507,624 D112N probably damaging Het
Abca7 T A 10: 80,009,944 I1580K probably damaging Het
Aebp1 A G 11: 5,865,059 D234G probably damaging Het
Agap1 T A 1: 89,455,431 M1K probably null Het
Agrn A T 4: 156,178,932 L345H probably damaging Het
Amfr A G 8: 93,999,126 M209T possibly damaging Het
Angel2 G A 1: 190,941,174 R338H possibly damaging Het
Ankrd27 C T 7: 35,631,249 A866V probably damaging Het
Apc G A 18: 34,315,271 R1740Q probably damaging Het
Arhgap32 A T 9: 32,256,937 S739C possibly damaging Het
Arhgap32 G C 9: 32,256,938 S739T probably benign Het
Arhgef2 C T 3: 88,635,885 S418L probably benign Het
Arhgef25 T C 10: 127,183,772 T472A possibly damaging Het
Atrnl1 C T 19: 57,650,414 S328F probably benign Het
Bahcc1 C T 11: 120,280,174 A1514V probably benign Het
Calcoco2 C T 11: 96,099,997 E305K unknown Het
Cdc42bpa A T 1: 180,061,797 K203* probably null Het
Cmc1 A T 9: 118,075,182 I47N possibly damaging Het
Cntln A G 4: 85,046,303 E656G possibly damaging Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dcun1d3 T C 7: 119,859,641 K57R possibly damaging Het
Ddx23 T C 15: 98,648,611 E559G probably damaging Het
Dennd6a G A 14: 26,612,038 R367Q probably damaging Het
Desi2 A T 1: 178,256,136 probably benign Het
Dido1 T C 2: 180,659,631 D2160G unknown Het
Epb41 A G 4: 131,991,209 probably null Het
Esrrb T A 12: 86,470,557 probably null Het
Fabp1 C A 6: 71,203,127 T94N probably benign Het
Fam120a A T 13: 48,892,006 C785S probably damaging Het
Foxc1 A G 13: 31,807,260 Y18C probably damaging Het
Fshr T C 17: 88,985,844 T469A probably benign Het
Gm11639 T C 11: 105,038,358 M4838T probably benign Het
Gm14399 T A 2: 175,130,411 H517L unknown Het
Gm39115 G T 7: 142,135,560 Q159K unknown Het
Gm7347 T A 5: 26,057,308 I72F possibly damaging Het
Gm9573 G A 17: 35,618,869 A1475V unknown Het
Hmcn1 A G 1: 150,683,715 V2395A possibly damaging Het
Ighv5-17 T G 12: 113,859,238 T88P probably damaging Het
Insm2 T A 12: 55,600,544 Y358N probably damaging Het
Kazn A T 4: 142,117,175 L409Q Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Kcnv2 A T 19: 27,333,684 T484S probably damaging Het
Kdm3b T C 18: 34,794,504 Y140H probably benign Het
Kif1bp A C 10: 62,566,116 C261W probably damaging Het
Krt25 C T 11: 99,321,272 A180T probably benign Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Nr3c1 T C 18: 39,414,601 T755A probably benign Het
Nr3c1 A T 18: 39,422,733 I517N probably benign Het
Nxpe2 A G 9: 48,323,039 probably null Het
Oaz1 C A 10: 80,826,839 T27K possibly damaging Het
Olfr1053 A G 2: 86,315,025 M87T probably benign Het
Olfr1093 G T 2: 86,786,690 C320F probably benign Het
Olfr1178 A T 2: 88,391,706 H153L probably damaging Het
Olfr1336 T A 7: 6,460,778 W90R probably benign Het
Olfr284 A G 15: 98,340,062 V309A probably damaging Het
Olfr561 T C 7: 102,775,427 I301T probably damaging Het
Pafah2 A T 4: 134,419,997 K319M probably damaging Het
Pask A T 1: 93,331,587 V236E probably damaging Het
Pcdh1 T C 18: 38,189,913 T956A probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Pcsk2 A T 2: 143,690,423 I164F probably damaging Het
Phf1 T C 17: 26,935,315 Y169H probably damaging Het
Pkdrej T A 15: 85,821,100 I212F probably benign Het
Pnkp T A 7: 44,858,690 W146R probably damaging Het
Prkcb A T 7: 122,544,687 I325F probably benign Het
Ptpn21 C T 12: 98,704,191 D239N probably benign Het
Ptprb A G 10: 116,328,165 T626A probably damaging Het
Raly G A 2: 154,861,854 R115Q probably damaging Het
Rims2 A T 15: 39,437,718 M474L probably benign Het
Sash1 A T 10: 8,730,196 I810N probably damaging Het
Scnn1g T A 7: 121,738,081 L55* probably null Het
Sema6b A T 17: 56,125,573 D543E possibly damaging Het
Serpina11 C T 12: 103,986,502 G5E unknown Het
Sesn3 A T 9: 14,276,552 M1L probably benign Het
Sez6 T A 11: 77,974,323 I632N possibly damaging Het
Sgo2b A T 8: 63,941,158 I49N probably damaging Het
Slc30a2 A T 4: 134,344,213 I86F possibly damaging Het
Slc38a6 T A 12: 73,287,012 W30R probably benign Het
Stk31 T G 6: 49,438,459 V576G probably benign Het
Szt2 G A 4: 118,375,878 T2297I unknown Het
Tmem208 T C 8: 105,334,786 F148S possibly damaging Het
Tprgl A G 4: 154,160,574 L19P possibly damaging Het
Tubg2 C A 11: 101,160,071 N207K probably damaging Het
Ube2n G T 10: 95,541,750 K130N probably benign Het
Usp36 T C 11: 118,273,529 Y384C probably damaging Het
Vcan A T 13: 89,692,733 L1564* probably null Het
Xkr6 A T 14: 63,798,299 D283V unknown Het
Zfp654 T C 16: 64,785,160 H352R probably benign Het
Zfp819 T A 7: 43,617,082 C330S probably damaging Het
Zfp970 G T 2: 177,475,293 C220F probably damaging Het
Other mutations in Pttg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1826:Pttg1 UTSW 11 43420366 missense probably damaging 0.98
R2433:Pttg1 UTSW 11 43420351 missense probably damaging 0.98
R4448:Pttg1 UTSW 11 43424690 intron probably benign
R4663:Pttg1 UTSW 11 43424850 nonsense probably null
R6483:Pttg1 UTSW 11 43424844 missense probably damaging 0.98
R7104:Pttg1 UTSW 11 43421149 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCCTAGCCTAAGCAGCTCTG -3'
(R):5'- ACTTTGAGAGTTTTGACCTGCC -3'

Sequencing Primer
(F):5'- GCCTAAGCAGCTCTGTGTTCAAC -3'
(R):5'- TTTGACCTGCCTGAGGAGCAC -3'
Posted On2019-06-26