Mutagenetix > Incidental Mutations

Incidental Mutation 'R7289:Usp36'

566261

Institutional Source

Beutler Lab

Gene Symbol

Usp36

Ensembl Gene

ENSMUSG00000033909

Gene Name

ubiquitin specific peptidase 36

Synonyms

2700002L06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.907) question?

Stock #

R7289 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118259651-118290244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118273529 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 384 (Y384C)

Ref Sequence

ENSEMBL: ENSMUSP00000090036 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092382
AA Change: Y384C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: Y384C

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106296
AA Change: Y384C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: Y384C

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000144153
AA Change: Y219C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: Y219C

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	T	4: 42,972,379	T571S	probably benign	Het
1700022I11Rik	A	T	4: 42,973,252	I862F	possibly damaging	Het
4930563D23Rik	T	C	16: 92,320,822	I193V	probably damaging	Het
Aars2	G	A	17: 45,507,624	D112N	probably damaging	Het
Abca7	T	A	10: 80,009,944	I1580K	probably damaging	Het
Aebp1	A	G	11: 5,865,059	D234G	probably damaging	Het
Agap1	T	A	1: 89,455,431	M1K	probably null	Het
Agrn	A	T	4: 156,178,932	L345H	probably damaging	Het
Amfr	A	G	8: 93,999,126	M209T	possibly damaging	Het
Angel2	G	A	1: 190,941,174	R338H	possibly damaging	Het
Ankrd27	C	T	7: 35,631,249	A866V	probably damaging	Het
Apc	G	A	18: 34,315,271	R1740Q	probably damaging	Het
Arhgap32	A	T	9: 32,256,937	S739C	possibly damaging	Het
Arhgap32	G	C	9: 32,256,938	S739T	probably benign	Het
Arhgef2	C	T	3: 88,635,885	S418L	probably benign	Het
Arhgef25	T	C	10: 127,183,772	T472A	possibly damaging	Het
Atrnl1	C	T	19: 57,650,414	S328F	probably benign	Het
Bahcc1	C	T	11: 120,280,174	A1514V	probably benign	Het
Calcoco2	C	T	11: 96,099,997	E305K	unknown	Het
Cdc42bpa	A	T	1: 180,061,797	K203*	probably null	Het
Cmc1	A	T	9: 118,075,182	I47N	possibly damaging	Het
Cntln	A	G	4: 85,046,303	E656G	possibly damaging	Het
Cyr61	C	T	3: 145,648,673	W161*	probably null	Het
Dcun1d3	T	C	7: 119,859,641	K57R	possibly damaging	Het
Ddx23	T	C	15: 98,648,611	E559G	probably damaging	Het
Dennd6a	G	A	14: 26,612,038	R367Q	probably damaging	Het
Desi2	A	T	1: 178,256,136		probably benign	Het
Dido1	T	C	2: 180,659,631	D2160G	unknown	Het
Epb41	A	G	4: 131,991,209		probably null	Het
Esrrb	T	A	12: 86,470,557		probably null	Het
Fabp1	C	A	6: 71,203,127	T94N	probably benign	Het
Fam120a	A	T	13: 48,892,006	C785S	probably damaging	Het
Foxc1	A	G	13: 31,807,260	Y18C	probably damaging	Het
Fshr	T	C	17: 88,985,844	T469A	probably benign	Het
Gm11639	T	C	11: 105,038,358	M4838T	probably benign	Het
Gm14399	T	A	2: 175,130,411	H517L	unknown	Het
Gm39115	G	T	7: 142,135,560	Q159K	unknown	Het
Gm7347	T	A	5: 26,057,308	I72F	possibly damaging	Het
Gm9573	G	A	17: 35,618,869	A1475V	unknown	Het
Hmcn1	A	G	1: 150,683,715	V2395A	possibly damaging	Het
Ighv5-17	T	G	12: 113,859,238	T88P	probably damaging	Het
Insm2	T	A	12: 55,600,544	Y358N	probably damaging	Het
Kazn	A	T	4: 142,117,175	L409Q		Het
Kcnj5	A	C	9: 32,322,749	L90R	probably damaging	Het
Kcnv2	A	T	19: 27,333,684	T484S	probably damaging	Het
Kdm3b	T	C	18: 34,794,504	Y140H	probably benign	Het
Kif1bp	A	C	10: 62,566,116	C261W	probably damaging	Het
Krt25	C	T	11: 99,321,272	A180T	probably benign	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Nr3c1	T	C	18: 39,414,601	T755A	probably benign	Het
Nr3c1	A	T	18: 39,422,733	I517N	probably benign	Het
Nxpe2	A	G	9: 48,323,039		probably null	Het
Oaz1	C	A	10: 80,826,839	T27K	possibly damaging	Het
Olfr1053	A	G	2: 86,315,025	M87T	probably benign	Het
Olfr1093	G	T	2: 86,786,690	C320F	probably benign	Het
Olfr1178	A	T	2: 88,391,706	H153L	probably damaging	Het
Olfr1336	T	A	7: 6,460,778	W90R	probably benign	Het
Olfr284	A	G	15: 98,340,062	V309A	probably damaging	Het
Olfr561	T	C	7: 102,775,427	I301T	probably damaging	Het
Pafah2	A	T	4: 134,419,997	K319M	probably damaging	Het
Pask	A	T	1: 93,331,587	V236E	probably damaging	Het
Pcdh1	T	C	18: 38,189,913	T956A	probably damaging	Het
Pcdhb18	C	A	18: 37,490,647	N343K	probably damaging	Het
Pcsk2	A	T	2: 143,690,423	I164F	probably damaging	Het
Phf1	T	C	17: 26,935,315	Y169H	probably damaging	Het
Pkdrej	T	A	15: 85,821,100	I212F	probably benign	Het
Pnkp	T	A	7: 44,858,690	W146R	probably damaging	Het
Prkcb	A	T	7: 122,544,687	I325F	probably benign	Het
Ptpn21	C	T	12: 98,704,191	D239N	probably benign	Het
Ptprb	A	G	10: 116,328,165	T626A	probably damaging	Het
Pttg1	T	C	11: 43,421,089	N180D	probably benign	Het
Raly	G	A	2: 154,861,854	R115Q	probably damaging	Het
Rims2	A	T	15: 39,437,718	M474L	probably benign	Het
Sash1	A	T	10: 8,730,196	I810N	probably damaging	Het
Scnn1g	T	A	7: 121,738,081	L55*	probably null	Het
Sema6b	A	T	17: 56,125,573	D543E	possibly damaging	Het
Serpina11	C	T	12: 103,986,502	G5E	unknown	Het
Sesn3	A	T	9: 14,276,552	M1L	probably benign	Het
Sez6	T	A	11: 77,974,323	I632N	possibly damaging	Het
Sgo2b	A	T	8: 63,941,158	I49N	probably damaging	Het
Slc30a2	A	T	4: 134,344,213	I86F	possibly damaging	Het
Slc38a6	T	A	12: 73,287,012	W30R	probably benign	Het
Stk31	T	G	6: 49,438,459	V576G	probably benign	Het
Szt2	G	A	4: 118,375,878	T2297I	unknown	Het
Tmem208	T	C	8: 105,334,786	F148S	possibly damaging	Het
Tprgl	A	G	4: 154,160,574	L19P	possibly damaging	Het
Tubg2	C	A	11: 101,160,071	N207K	probably damaging	Het
Ube2n	G	T	10: 95,541,750	K130N	probably benign	Het
Vcan	A	T	13: 89,692,733	L1564*	probably null	Het
Xkr6	A	T	14: 63,798,299	D283V	unknown	Het
Zfp654	T	C	16: 64,785,160	H352R	probably benign	Het
Zfp819	T	A	7: 43,617,082	C330S	probably damaging	Het
Zfp970	G	T	2: 177,475,293	C220F	probably damaging	Het

Other mutations in Usp36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Usp36	APN	11	118264820	missense	possibly damaging	0.76
IGL01115:Usp36	APN	11	118285960	missense	probably damaging	1.00
IGL01720:Usp36	APN	11	118275002	missense	probably damaging	0.99
IGL02410:Usp36	APN	11	118276185	missense	probably damaging	1.00
IGL02700:Usp36	APN	11	118276157	missense	possibly damaging	0.95
IGL02926:Usp36	APN	11	118264783	missense	probably benign	0.22
IGL03145:Usp36	APN	11	118279241	missense	probably damaging	1.00
IGL03203:Usp36	APN	11	118285810	missense	probably benign	0.42
IGL03265:Usp36	APN	11	118264809	missense	possibly damaging	0.65
R0482:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R0499:Usp36	UTSW	11	118273571	missense	probably damaging	0.98
R0606:Usp36	UTSW	11	118263028	splice site	probably benign
R0646:Usp36	UTSW	11	118273021	missense	probably damaging	1.00
R1579:Usp36	UTSW	11	118284945	missense	probably damaging	1.00
R1646:Usp36	UTSW	11	118273566	missense	probably damaging	1.00
R1716:Usp36	UTSW	11	118272131	critical splice donor site	probably null
R1886:Usp36	UTSW	11	118272958	missense	probably damaging	1.00
R2014:Usp36	UTSW	11	118262508	splice site	probably benign
R2068:Usp36	UTSW	11	118275018	missense	possibly damaging	0.80
R2146:Usp36	UTSW	11	118268665	missense	probably benign	0.02
R2191:Usp36	UTSW	11	118285023	missense	possibly damaging	0.95
R2899:Usp36	UTSW	11	118276756	splice site	probably benign
R3176:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3177:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3276:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3277:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3615:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3616:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3768:Usp36	UTSW	11	118263052	missense	probably damaging	1.00
R3899:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R3900:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R4484:Usp36	UTSW	11	118285795	missense	probably damaging	0.99
R4809:Usp36	UTSW	11	118263070	missense	probably damaging	1.00
R5135:Usp36	UTSW	11	118264905	missense	possibly damaging	0.58
R5323:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R6226:Usp36	UTSW	11	118277274	missense	probably damaging	1.00
R6266:Usp36	UTSW	11	118268585	missense	probably damaging	1.00
R7191:Usp36	UTSW	11	118268834	missense	probably benign	0.39
R7215:Usp36	UTSW	11	118265154	missense	possibly damaging	0.87
R7535:Usp36	UTSW	11	118262046	missense	possibly damaging	0.92
R7675:Usp36	UTSW	11	118263696	missense	probably benign	0.11
R7843:Usp36	UTSW	11	118285965	missense	probably damaging	1.00
R8228:Usp36	UTSW	11	118264890	missense	possibly damaging	0.77
X0020:Usp36	UTSW	11	118273613	missense	probably damaging	1.00
Z1177:Usp36	UTSW	11	118276200	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGTTTATGGGAAGGAGAACC -3'
(R):5'- AAGATTGGTCAGCACAAGCATTG -3'

Sequencing Primer
(F):5'- CCGTTTATGGGAAGGAGAACCAAAAC -3'
(R):5'- TCAGCACAAGCATTGCTGAG -3'

Posted On

2019-06-26