Mutagenetix > Incidental Mutations

Incidental Mutation 'R7289:Arhgap32'

566243

Institutional Source

Beutler Lab

Gene Symbol

Arhgap32

Ensembl Gene

ENSMUSG00000041444

Gene Name

Rho GTPase activating protein 32

Synonyms

p200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7289 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32116136-32268446 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 32256938 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 739 (S739T)

Ref Sequence

ENSEMBL: ENSMUSP00000138145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]

Predicted Effect

probably benign
Transcript: ENSMUST00000168954
AA Change: S739T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: S739T

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174641
AA Change: S1088T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: S1088T

Domain	Start	End	E-Value	Type
Pfam:PX	132	226	5.6e-7	PFAM
SH3	262	320	7.4e-11	SMART
RhoGAP	383	564	9.6e-60	SMART
Blast:RhoGAP	581	647	9e-31	BLAST
low complexity region	867	882	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1045	1059	N/A	INTRINSIC
low complexity region	1262	1275	N/A	INTRINSIC
low complexity region	1309	1323	N/A	INTRINSIC
low complexity region	1346	1357	N/A	INTRINSIC
low complexity region	1425	1442	N/A	INTRINSIC
low complexity region	1653	1666	N/A	INTRINSIC
low complexity region	2040	2049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182802
AA Change: S739T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: S739T

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	T	4: 42,972,379	T571S	probably benign	Het
1700022I11Rik	A	T	4: 42,973,252	I862F	possibly damaging	Het
4930563D23Rik	T	C	16: 92,320,822	I193V	probably damaging	Het
Aars2	G	A	17: 45,507,624	D112N	probably damaging	Het
Abca7	T	A	10: 80,009,944	I1580K	probably damaging	Het
Aebp1	A	G	11: 5,865,059	D234G	probably damaging	Het
Agap1	T	A	1: 89,455,431	M1K	probably null	Het
Agrn	A	T	4: 156,178,932	L345H	probably damaging	Het
Amfr	A	G	8: 93,999,126	M209T	possibly damaging	Het
Angel2	G	A	1: 190,941,174	R338H	possibly damaging	Het
Ankrd27	C	T	7: 35,631,249	A866V	probably damaging	Het
Apc	G	A	18: 34,315,271	R1740Q	probably damaging	Het
Arhgef2	C	T	3: 88,635,885	S418L	probably benign	Het
Arhgef25	T	C	10: 127,183,772	T472A	possibly damaging	Het
Atrnl1	C	T	19: 57,650,414	S328F	probably benign	Het
Bahcc1	C	T	11: 120,280,174	A1514V	probably benign	Het
Calcoco2	C	T	11: 96,099,997	E305K	unknown	Het
Cdc42bpa	A	T	1: 180,061,797	K203*	probably null	Het
Cmc1	A	T	9: 118,075,182	I47N	possibly damaging	Het
Cntln	A	G	4: 85,046,303	E656G	possibly damaging	Het
Cyr61	C	T	3: 145,648,673	W161*	probably null	Het
Dcun1d3	T	C	7: 119,859,641	K57R	possibly damaging	Het
Ddx23	T	C	15: 98,648,611	E559G	probably damaging	Het
Dennd6a	G	A	14: 26,612,038	R367Q	probably damaging	Het
Desi2	A	T	1: 178,256,136		probably benign	Het
Dido1	T	C	2: 180,659,631	D2160G	unknown	Het
Epb41	A	G	4: 131,991,209		probably null	Het
Esrrb	T	A	12: 86,470,557		probably null	Het
Fabp1	C	A	6: 71,203,127	T94N	probably benign	Het
Fam120a	A	T	13: 48,892,006	C785S	probably damaging	Het
Foxc1	A	G	13: 31,807,260	Y18C	probably damaging	Het
Fshr	T	C	17: 88,985,844	T469A	probably benign	Het
Gm11639	T	C	11: 105,038,358	M4838T	probably benign	Het
Gm14399	T	A	2: 175,130,411	H517L	unknown	Het
Gm39115	G	T	7: 142,135,560	Q159K	unknown	Het
Gm7347	T	A	5: 26,057,308	I72F	possibly damaging	Het
Gm9573	G	A	17: 35,618,869	A1475V	unknown	Het
Hmcn1	A	G	1: 150,683,715	V2395A	possibly damaging	Het
Ighv5-17	T	G	12: 113,859,238	T88P	probably damaging	Het
Insm2	T	A	12: 55,600,544	Y358N	probably damaging	Het
Kazn	A	T	4: 142,117,175	L409Q		Het
Kcnj5	A	C	9: 32,322,749	L90R	probably damaging	Het
Kcnv2	A	T	19: 27,333,684	T484S	probably damaging	Het
Kdm3b	T	C	18: 34,794,504	Y140H	probably benign	Het
Kif1bp	A	C	10: 62,566,116	C261W	probably damaging	Het
Krt25	C	T	11: 99,321,272	A180T	probably benign	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Nr3c1	T	C	18: 39,414,601	T755A	probably benign	Het
Nr3c1	A	T	18: 39,422,733	I517N	probably benign	Het
Nxpe2	A	G	9: 48,323,039		probably null	Het
Oaz1	C	A	10: 80,826,839	T27K	possibly damaging	Het
Olfr1053	A	G	2: 86,315,025	M87T	probably benign	Het
Olfr1093	G	T	2: 86,786,690	C320F	probably benign	Het
Olfr1178	A	T	2: 88,391,706	H153L	probably damaging	Het
Olfr1336	T	A	7: 6,460,778	W90R	probably benign	Het
Olfr284	A	G	15: 98,340,062	V309A	probably damaging	Het
Olfr561	T	C	7: 102,775,427	I301T	probably damaging	Het
Pafah2	A	T	4: 134,419,997	K319M	probably damaging	Het
Pask	A	T	1: 93,331,587	V236E	probably damaging	Het
Pcdh1	T	C	18: 38,189,913	T956A	probably damaging	Het
Pcdhb18	C	A	18: 37,490,647	N343K	probably damaging	Het
Pcsk2	A	T	2: 143,690,423	I164F	probably damaging	Het
Phf1	T	C	17: 26,935,315	Y169H	probably damaging	Het
Pkdrej	T	A	15: 85,821,100	I212F	probably benign	Het
Pnkp	T	A	7: 44,858,690	W146R	probably damaging	Het
Prkcb	A	T	7: 122,544,687	I325F	probably benign	Het
Ptpn21	C	T	12: 98,704,191	D239N	probably benign	Het
Ptprb	A	G	10: 116,328,165	T626A	probably damaging	Het
Pttg1	T	C	11: 43,421,089	N180D	probably benign	Het
Raly	G	A	2: 154,861,854	R115Q	probably damaging	Het
Rims2	A	T	15: 39,437,718	M474L	probably benign	Het
Sash1	A	T	10: 8,730,196	I810N	probably damaging	Het
Scnn1g	T	A	7: 121,738,081	L55*	probably null	Het
Sema6b	A	T	17: 56,125,573	D543E	possibly damaging	Het
Serpina11	C	T	12: 103,986,502	G5E	unknown	Het
Sesn3	A	T	9: 14,276,552	M1L	probably benign	Het
Sez6	T	A	11: 77,974,323	I632N	possibly damaging	Het
Sgo2b	A	T	8: 63,941,158	I49N	probably damaging	Het
Slc30a2	A	T	4: 134,344,213	I86F	possibly damaging	Het
Slc38a6	T	A	12: 73,287,012	W30R	probably benign	Het
Stk31	T	G	6: 49,438,459	V576G	probably benign	Het
Szt2	G	A	4: 118,375,878	T2297I	unknown	Het
Tmem208	T	C	8: 105,334,786	F148S	possibly damaging	Het
Tprgl	A	G	4: 154,160,574	L19P	possibly damaging	Het
Tubg2	C	A	11: 101,160,071	N207K	probably damaging	Het
Ube2n	G	T	10: 95,541,750	K130N	probably benign	Het
Usp36	T	C	11: 118,273,529	Y384C	probably damaging	Het
Vcan	A	T	13: 89,692,733	L1564*	probably null	Het
Xkr6	A	T	14: 63,798,299	D283V	unknown	Het
Zfp654	T	C	16: 64,785,160	H352R	probably benign	Het
Zfp819	T	A	7: 43,617,082	C330S	probably damaging	Het
Zfp970	G	T	2: 177,475,293	C220F	probably damaging	Het

Other mutations in Arhgap32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Arhgap32	APN	9	32257361	missense	probably benign	0.00
IGL01317:Arhgap32	APN	9	32256964	missense	probably benign	0.30
IGL01614:Arhgap32	APN	9	32260505	missense	probably damaging	1.00
IGL01791:Arhgap32	APN	9	32247190	missense	probably damaging	0.96
IGL02318:Arhgap32	APN	9	32259331	missense	probably benign	0.00
IGL02542:Arhgap32	APN	9	32255648	missense	probably damaging	1.00
IGL02568:Arhgap32	APN	9	32247194	missense	probably damaging	1.00
IGL02627:Arhgap32	APN	9	32246006	missense	probably damaging	1.00
IGL02927:Arhgap32	APN	9	32261135	missense	possibly damaging	0.95
IGL03157:Arhgap32	APN	9	32259134	missense	probably damaging	1.00
IGL03286:Arhgap32	APN	9	32259520	missense	probably benign	0.06
PIT4445001:Arhgap32	UTSW	9	32260856	missense	probably damaging	1.00
R0004:Arhgap32	UTSW	9	32151998	missense	probably damaging	0.98
R0335:Arhgap32	UTSW	9	32259760	missense	probably benign	0.00
R0380:Arhgap32	UTSW	9	32246477	missense	probably damaging	1.00
R0396:Arhgap32	UTSW	9	32245255	critical splice donor site	probably null
R0494:Arhgap32	UTSW	9	32258903	missense	probably damaging	0.98
R0508:Arhgap32	UTSW	9	32190068	splice site	probably benign
R0856:Arhgap32	UTSW	9	32260220	missense	probably damaging	1.00
R0990:Arhgap32	UTSW	9	32255381	missense	probably damaging	1.00
R1312:Arhgap32	UTSW	9	32255312	missense	probably benign
R1455:Arhgap32	UTSW	9	32260085	missense	probably benign	0.08
R1515:Arhgap32	UTSW	9	32116202	missense	probably benign
R1523:Arhgap32	UTSW	9	32256752	missense	probably damaging	1.00
R1651:Arhgap32	UTSW	9	32259800	missense	probably damaging	1.00
R1743:Arhgap32	UTSW	9	32259431	missense	probably benign	0.00
R1999:Arhgap32	UTSW	9	32116140	missense	possibly damaging	0.52
R2098:Arhgap32	UTSW	9	32259911	missense	probably damaging	1.00
R2150:Arhgap32	UTSW	9	32116140	missense	possibly damaging	0.52
R2256:Arhgap32	UTSW	9	32247497	missense	probably damaging	0.99
R2257:Arhgap32	UTSW	9	32247497	missense	probably damaging	0.99
R2989:Arhgap32	UTSW	9	32239398	missense	possibly damaging	0.54
R3780:Arhgap32	UTSW	9	32152019	splice site	probably null
R3793:Arhgap32	UTSW	9	32255373	missense	probably damaging	1.00
R3846:Arhgap32	UTSW	9	32190024	missense	probably benign	0.03
R4086:Arhgap32	UTSW	9	32247066	unclassified	probably benign
R4177:Arhgap32	UTSW	9	32247214	missense	probably null	1.00
R4230:Arhgap32	UTSW	9	32257474	missense	probably benign	0.10
R4280:Arhgap32	UTSW	9	32259889	missense	probably damaging	0.98
R4504:Arhgap32	UTSW	9	32181839	splice site	probably null
R4587:Arhgap32	UTSW	9	32260945	missense	probably benign	0.02
R4612:Arhgap32	UTSW	9	32259479	missense	probably damaging	0.99
R4622:Arhgap32	UTSW	9	32239348	missense	possibly damaging	0.75
R4670:Arhgap32	UTSW	9	32170145	missense	probably benign	0.03
R4784:Arhgap32	UTSW	9	32129653	missense	probably damaging	0.99
R4784:Arhgap32	UTSW	9	32260780	missense	probably damaging	1.00
R4785:Arhgap32	UTSW	9	32129653	missense	probably damaging	0.99
R4785:Arhgap32	UTSW	9	32260780	missense	probably damaging	1.00
R4906:Arhgap32	UTSW	9	32245256	critical splice donor site	probably null
R5046:Arhgap32	UTSW	9	32256799	missense	probably damaging	1.00
R5360:Arhgap32	UTSW	9	32259671	missense	probably damaging	1.00
R5382:Arhgap32	UTSW	9	32152010	missense	probably damaging	1.00
R5445:Arhgap32	UTSW	9	32248382	missense	probably benign	0.19
R5637:Arhgap32	UTSW	9	32247206	missense	probably damaging	1.00
R5659:Arhgap32	UTSW	9	32181960	missense	probably damaging	1.00
R5801:Arhgap32	UTSW	9	32255788	missense	probably benign	0.01
R6002:Arhgap32	UTSW	9	32256979	missense	probably benign	0.00
R6109:Arhgap32	UTSW	9	32260111	missense	probably damaging	1.00
R6405:Arhgap32	UTSW	9	32248488	missense	probably benign	0.31
R6922:Arhgap32	UTSW	9	32152687	missense	possibly damaging	0.86
R7009:Arhgap32	UTSW	9	32245976	missense	probably damaging	1.00
R7137:Arhgap32	UTSW	9	32151936	missense	probably benign	0.32
R7183:Arhgap32	UTSW	9	32186383	missense	probably benign	0.15
R7251:Arhgap32	UTSW	9	32208185	missense	probably damaging	1.00
R7287:Arhgap32	UTSW	9	32152697	missense
R7289:Arhgap32	UTSW	9	32256937	missense	possibly damaging	0.92
R7391:Arhgap32	UTSW	9	32181939	missense	probably benign	0.00
R7408:Arhgap32	UTSW	9	32245924	missense	probably benign	0.06
R7566:Arhgap32	UTSW	9	32250722	missense	probably benign	0.10
R7584:Arhgap32	UTSW	9	32256967	missense	probably benign	0.16
R7653:Arhgap32	UTSW	9	32257145	missense	probably benign
R7884:Arhgap32	UTSW	9	32260514	missense	possibly damaging	0.87
R8087:Arhgap32	UTSW	9	32257028	missense	probably benign	0.00
R8109:Arhgap32	UTSW	9	32181854	missense	probably benign	0.09
R8131:Arhgap32	UTSW	9	32247130	missense	probably damaging	1.00
R8155:Arhgap32	UTSW	9	32181900	missense	probably damaging	1.00
R8232:Arhgap32	UTSW	9	32256902	missense	probably damaging	1.00
R8303:Arhgap32	UTSW	9	32260909	missense	probably benign	0.00
R8304:Arhgap32	UTSW	9	32255937	nonsense	probably null
X0027:Arhgap32	UTSW	9	32250641	critical splice acceptor site	probably null
X0063:Arhgap32	UTSW	9	32261069	missense	probably damaging	1.00
Z1177:Arhgap32	UTSW	9	32260680	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GATCCCGTTCCTGTCAGTTCAG -3'
(R):5'- AGGGAGCTGAAGTGCTTCTAG -3'

Sequencing Primer
(F):5'- GTCAGTTCAGTCTCTCTTATCCCAC -3'
(R):5'- CCCCAGATATATGGTTTCGATGTAGC -3'

Posted On

2019-06-26