Incidental Mutation 'R7319:Sgf29'
ID 568061
Institutional Source Beutler Lab
Gene Symbol Sgf29
Ensembl Gene ENSMUSG00000030714
Gene Name SAGA complex associated factor 29
Synonyms 1700023O11Rik, Ccdc101
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7319 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 126649309-126672925 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 126671649 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 134 (I134T)
Ref Sequence ENSEMBL: ENSMUSP00000032956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032956] [ENSMUST00000106371] [ENSMUST00000106372] [ENSMUST00000106373] [ENSMUST00000155419] [ENSMUST00000205507] [ENSMUST00000206359]
AlphaFold Q9DA08
Predicted Effect probably benign
Transcript: ENSMUST00000032956
AA Change: I134T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032956
Gene: ENSMUSG00000030714
AA Change: I134T

DomainStartEndE-ValueType
coiled coil region 66 86 N/A INTRINSIC
Pfam:DUF1325 158 288 5.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106371
SMART Domains Protein: ENSMUSP00000101979
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 256 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106372
SMART Domains Protein: ENSMUSP00000101980
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 41 263 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106373
SMART Domains Protein: ENSMUSP00000101981
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 284 1.1e-89 PFAM
Pfam:Sulfotransfer_3 36 210 2.9e-10 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000155419
SMART Domains Protein: ENSMUSP00000121514
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 121 6e-23 PFAM
Pfam:Sulfotransfer_1 133 181 1.5e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205507
AA Change: I134T

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000206359
AA Change: I134T

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCDC101 is a subunit of 2 histone acetyltransferase complexes: the ADA2A (TADA2A; MIM 602276)-containing (ATAC) complex and the SPT3 (SUPT3H; MIM 602947)-TAF9 (MIM 600822)-GCN5 (KAT2A; MIM 602301)/PCAF (KAT2B; MIM 602303) acetylase (STAGA) complex. Both of these complexes contain either GCN5 or PCAF, which are paralogous acetyltransferases (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G A 5: 90,571,766 probably null Het
9930012K11Rik A T 14: 70,156,186 I287N probably benign Het
Aco2 G T 15: 81,903,619 E223D probably damaging Het
Acsf3 T A 8: 122,813,031 I466N probably damaging Het
Aox3 T A 1: 58,152,602 F438I probably benign Het
Arhgap33 T C 7: 30,526,369 T591A probably benign Het
Ash1l C T 3: 88,981,387 A191V probably benign Het
Btg2 T C 1: 134,079,041 K5E probably benign Het
C1galt1 T A 6: 7,871,150 Y329N probably damaging Het
C87499 G A 4: 88,629,947 P74S probably benign Het
Cacna1h A G 17: 25,389,461 I824T possibly damaging Het
Carmil3 A G 14: 55,494,360 I182V probably benign Het
Ccdc150 T A 1: 54,263,337 probably null Het
Chek1 T A 9: 36,722,643 R129W probably damaging Het
Chrna6 A G 8: 27,406,787 M354T possibly damaging Het
Cpq A G 15: 33,250,039 T181A probably benign Het
Csmd2 A T 4: 128,393,679 Y1069F Het
Defb28 T A 2: 152,520,054 C45S possibly damaging Het
Dnah1 A G 14: 31,296,594 Y1360H probably benign Het
Dnah7c T A 1: 46,780,775 D3728E probably benign Het
Dnah7c T C 1: 46,784,448 V3749A possibly damaging Het
Dym G A 18: 75,063,174 probably null Het
Dzip3 A G 16: 48,927,540 probably null Het
Eef1akmt4 A G 16: 20,617,916 K163E probably benign Het
Fbrs A G 7: 127,482,813 T242A possibly damaging Het
Fgfr3 G A 5: 33,727,802 V87M possibly damaging Het
Fst A T 13: 114,458,532 C19S probably benign Het
Gm7276 G A 18: 77,185,520 R173W unknown Het
Gm9195 G A 14: 72,460,489 H1284Y probably benign Het
Gm9573 GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG GGGGTGGG 17: 35,622,043 probably benign Het
Herc6 C A 6: 57,604,089 T258K probably damaging Het
Hip1r A G 5: 123,999,111 Y678C probably damaging Het
Ifne A T 4: 88,880,006 N58K probably damaging Het
Ighv1-26 A T 12: 114,788,543 H60Q possibly damaging Het
Ints1 A G 5: 139,760,765 F1276L probably damaging Het
Kcnc4 T A 3: 107,458,784 E36V probably benign Het
Kcnq2 C T 2: 181,109,102 G315S probably damaging Het
Kdm4c G A 4: 74,336,963 V585M probably damaging Het
Klhl26 C T 8: 70,452,942 R106H probably damaging Het
Kmo T C 1: 175,653,655 F313S probably damaging Het
Lmtk3 T A 7: 45,794,316 S808T unknown Het
Lrch3 A G 16: 32,994,993 T585A probably benign Het
Lrch4 T A 5: 137,639,715 H86Q Het
Map3k20 A G 2: 72,364,718 D113G probably damaging Het
Mbd3l1 T C 9: 18,485,121 S181P probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Med27 A G 2: 29,413,478 R147G possibly damaging Het
Mrps5 T A 2: 127,595,842 S196R possibly damaging Het
Myo16 A T 8: 10,476,185 probably null Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Pcdha11 C T 18: 37,013,192 P779S probably benign Het
Phykpl A G 11: 51,598,703 T379A probably benign Het
Plekha8 A C 6: 54,624,221 M270L probably benign Het
Plekhg5 A G 4: 152,108,428 H593R probably benign Het
Polr2a T C 11: 69,746,370 N293S possibly damaging Het
Prex2 T A 1: 11,162,308 N866K probably benign Het
Psme4 A T 11: 30,807,790 I308L probably benign Het
Ptprb T C 10: 116,341,404 V1003A probably benign Het
Rbbp8 T A 18: 11,732,212 D719E probably damaging Het
Rnaset2b A T 17: 6,991,767 D144V probably benign Het
Senp6 T G 9: 80,126,199 D662E probably damaging Het
Serpinb3c T C 1: 107,273,087 N200S possibly damaging Het
Serpinb9g C G 13: 33,488,560 Y113* probably null Het
Sh3bp4 T G 1: 89,153,102 probably null Het
Ssfa2 A T 2: 79,636,072 D82V probably damaging Het
Stab1 G A 14: 31,140,826 L2243F probably damaging Het
Sympk T C 7: 19,035,845 V149A probably benign Het
Syt3 C T 7: 44,392,529 Q271* probably null Het
Tas2r109 A G 6: 132,980,700 I89T probably benign Het
Tgif1 A G 17: 70,844,852 S255P probably damaging Het
Tm9sf1 G A 14: 55,637,975 probably benign Het
Tnf A G 17: 35,200,371 F161S possibly damaging Het
Topaz1 T A 9: 122,750,363 S779R possibly damaging Het
Topors A G 4: 40,260,540 S915P unknown Het
Tpm4 C T 8: 72,146,477 L161F probably damaging Het
Trim38 C T 13: 23,791,401 T441I probably damaging Het
Trpv1 A G 11: 73,250,794 M548V probably benign Het
Vmn2r68 T A 7: 85,233,834 T237S probably benign Het
Wdr34 G A 2: 30,038,329 P95L probably benign Het
Zc3hav1 A G 6: 38,332,274 S538P probably benign Het
Zfp541 C T 7: 16,079,369 T649I probably benign Het
Other mutations in Sgf29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Sgf29 APN 7 126664931 missense possibly damaging 0.94
IGL02546:Sgf29 APN 7 126671853 missense probably damaging 1.00
xiangfan UTSW 7 126663938 missense possibly damaging 0.90
R0280:Sgf29 UTSW 7 126671571 missense probably benign 0.45
R1438:Sgf29 UTSW 7 126671891 splice site probably null
R1987:Sgf29 UTSW 7 126649477 splice site probably null
R4342:Sgf29 UTSW 7 126671777 missense probably damaging 1.00
R4489:Sgf29 UTSW 7 126663938 missense possibly damaging 0.90
R4869:Sgf29 UTSW 7 126649375 unclassified probably benign
R4928:Sgf29 UTSW 7 126664982 missense probably damaging 1.00
R7122:Sgf29 UTSW 7 126672049 missense probably null 0.44
R7902:Sgf29 UTSW 7 126672178 missense probably damaging 1.00
R8152:Sgf29 UTSW 7 126672654 missense possibly damaging 0.46
R8395:Sgf29 UTSW 7 126672665 nonsense probably null
R8509:Sgf29 UTSW 7 126671662 critical splice donor site probably benign
R9072:Sgf29 UTSW 7 126672654 missense probably damaging 1.00
R9073:Sgf29 UTSW 7 126672654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGTGCTCCAGCTCAGAG -3'
(R):5'- CAGCTAGGATCCACTGTTCATCC -3'

Sequencing Primer
(F):5'- GCAGTTGCTGGGTGTGAC -3'
(R):5'- AGGATCCACTGTTCATCCCCTTC -3'
Posted On 2019-06-26