Incidental Mutation 'R4342:Sgf29'
ID 324175
Institutional Source Beutler Lab
Gene Symbol Sgf29
Ensembl Gene ENSMUSG00000030714
Gene Name SAGA complex associated factor 29
Synonyms 1700023O11Rik, Ccdc101
MMRRC Submission 041100-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4342 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 126649309-126672925 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 126671777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 143 (C143Y)
Ref Sequence ENSEMBL: ENSMUSP00000145562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032956] [ENSMUST00000106371] [ENSMUST00000106372] [ENSMUST00000106373] [ENSMUST00000155419] [ENSMUST00000205507] [ENSMUST00000206359]
AlphaFold Q9DA08
Predicted Effect possibly damaging
Transcript: ENSMUST00000032956
AA Change: V155M

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032956
Gene: ENSMUSG00000030714
AA Change: V155M

DomainStartEndE-ValueType
coiled coil region 66 86 N/A INTRINSIC
Pfam:DUF1325 158 288 5.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106371
SMART Domains Protein: ENSMUSP00000101979
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 256 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106372
SMART Domains Protein: ENSMUSP00000101980
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 41 263 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106373
SMART Domains Protein: ENSMUSP00000101981
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 284 1.1e-89 PFAM
Pfam:Sulfotransfer_3 36 210 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123382
Predicted Effect unknown
Transcript: ENSMUST00000129786
AA Change: V45M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152231
Predicted Effect probably benign
Transcript: ENSMUST00000155419
SMART Domains Protein: ENSMUSP00000121514
Gene: ENSMUSG00000030711

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 121 6e-23 PFAM
Pfam:Sulfotransfer_1 133 181 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205507
AA Change: M152I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably damaging
Transcript: ENSMUST00000206359
AA Change: C143Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCDC101 is a subunit of 2 histone acetyltransferase complexes: the ADA2A (TADA2A; MIM 602276)-containing (ATAC) complex and the SPT3 (SUPT3H; MIM 602947)-TAF9 (MIM 600822)-GCN5 (KAT2A; MIM 602301)/PCAF (KAT2B; MIM 602303) acetylase (STAGA) complex. Both of these complexes contain either GCN5 or PCAF, which are paralogous acetyltransferases (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,495 C488R probably benign Het
Adamts19 A T 18: 58,942,500 H489L probably damaging Het
Ahnak T C 19: 9,012,083 V3577A possibly damaging Het
Arhgap44 G A 11: 65,012,061 R401* probably null Het
Cbx3-ps2 T C 13: 65,559,688 noncoding transcript Het
Ccdc174 T A 6: 91,885,356 L86* probably null Het
Cd38 A C 5: 43,869,089 I72L probably benign Het
Cers4 T C 8: 4,521,223 L264P probably damaging Het
Cldn23 A G 8: 35,825,498 S279P probably benign Het
Cth T A 3: 157,924,976 T19S probably damaging Het
Dnajc22 T A 15: 99,104,464 L330* probably null Het
Epas1 G A 17: 86,823,800 C336Y probably damaging Het
Evi5l A C 8: 4,183,492 probably benign Het
Fam71b A G 11: 46,407,216 D449G possibly damaging Het
Fbxl2 A T 9: 113,985,306 H272Q probably benign Het
Fgd3 C T 13: 49,273,709 probably null Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fscn1 T C 5: 142,972,021 Y308H probably damaging Het
Gm5878 G A 6: 85,125,651 R31* probably null Het
Gm996 A G 2: 25,579,108 Y264H possibly damaging Het
Gpatch2l T C 12: 86,260,679 V277A probably benign Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grin2a A G 16: 9,653,589 I605T possibly damaging Het
Hoxc11 C T 15: 102,954,671 S49F probably damaging Het
Igf2r C T 17: 12,709,511 E982K possibly damaging Het
Ighv10-3 A T 12: 114,523,504 M99K possibly damaging Het
Itgb4 A T 11: 115,988,729 T614S probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mast4 A G 13: 102,774,248 V461A probably damaging Het
Mcts2 G A 2: 152,687,664 V132M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Nbeal2 A G 9: 110,631,793 probably benign Het
Nek4 T C 14: 30,953,906 V66A probably damaging Het
Nfasc A G 1: 132,631,705 F229S probably damaging Het
Nhsl1 T C 10: 18,526,689 F1221S probably damaging Het
Nr1d1 T G 11: 98,771,814 K118Q probably damaging Het
Ntm T C 9: 29,109,431 E164G probably damaging Het
Olfr576 A G 7: 102,966,024 N308S probably benign Het
Parp1 G T 1: 180,587,329 A411S probably benign Het
Pds5b A G 5: 150,800,854 T1301A probably benign Het
Pkhd1 A G 1: 20,058,617 V3954A probably benign Het
Pkp4 A T 2: 59,350,608 K739I probably damaging Het
Pla2g4e T C 2: 120,186,446 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ralgds T C 2: 28,552,095 L96P probably damaging Het
Rbm6 A T 9: 107,847,247 probably benign Het
Scp2d1 T C 2: 144,824,167 L142P probably damaging Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Slc22a12 A G 19: 6,541,099 I156T probably benign Het
Stambpl1 A G 19: 34,234,046 Q169R probably benign Het
Tex2 T C 11: 106,567,006 probably benign Het
Trip11 A T 12: 101,884,316 I878N probably damaging Het
Ttf1 C T 2: 29,065,476 S284L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b5 A T 5: 87,139,723 V195E probably damaging Het
Vmn1r14 T A 6: 57,233,823 Y85N probably benign Het
Wdyhv1 T C 15: 58,152,714 S120P probably benign Het
Zfp131 C T 13: 119,776,018 R268H probably damaging Het
Other mutations in Sgf29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Sgf29 APN 7 126664931 missense possibly damaging 0.94
IGL02546:Sgf29 APN 7 126671853 missense probably damaging 1.00
xiangfan UTSW 7 126663938 missense possibly damaging 0.90
R0280:Sgf29 UTSW 7 126671571 missense probably benign 0.45
R1438:Sgf29 UTSW 7 126671891 splice site probably null
R1987:Sgf29 UTSW 7 126649477 splice site probably null
R4489:Sgf29 UTSW 7 126663938 missense possibly damaging 0.90
R4869:Sgf29 UTSW 7 126649375 unclassified probably benign
R4928:Sgf29 UTSW 7 126664982 missense probably damaging 1.00
R7122:Sgf29 UTSW 7 126672049 missense probably null 0.44
R7319:Sgf29 UTSW 7 126671649 missense probably benign 0.00
R7902:Sgf29 UTSW 7 126672178 missense probably damaging 1.00
R8152:Sgf29 UTSW 7 126672654 missense possibly damaging 0.46
R8395:Sgf29 UTSW 7 126672665 nonsense probably null
R8509:Sgf29 UTSW 7 126671662 critical splice donor site probably benign
R9072:Sgf29 UTSW 7 126672654 missense probably damaging 1.00
R9073:Sgf29 UTSW 7 126672654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGATGACACTGCTGCAG -3'
(R):5'- AGGCACAGTTTATATCTGGGAG -3'

Sequencing Primer
(F):5'- AGCAGTCCGCCATGACC -3'
(R):5'- CACAGTTTATATCTGGGAGTGGGG -3'
Posted On 2015-06-24