Incidental Mutation 'R0280:Sgf29'
Institutional Source Beutler Lab
Gene Symbol Sgf29
Ensembl Gene ENSMUSG00000030714
Gene NameSAGA complex associated factor 29
Synonyms1700023O11Rik, Ccdc101
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0280 (G1)
Quality Score152
Status Validated
Chromosomal Location126649309-126672925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126671571 bp
Amino Acid Change Glutamic Acid to Glycine at position 108 (E108G)
Ref Sequence ENSEMBL: ENSMUSP00000145562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032956] [ENSMUST00000106371] [ENSMUST00000106372] [ENSMUST00000106373] [ENSMUST00000155419] [ENSMUST00000205507] [ENSMUST00000206359]
Predicted Effect probably benign
Transcript: ENSMUST00000032956
AA Change: E108G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032956
Gene: ENSMUSG00000030714
AA Change: E108G

coiled coil region 66 86 N/A INTRINSIC
Pfam:DUF1325 158 288 5.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106371
SMART Domains Protein: ENSMUSP00000101979
Gene: ENSMUSG00000030711

Pfam:Sulfotransfer_1 34 256 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106372
SMART Domains Protein: ENSMUSP00000101980
Gene: ENSMUSG00000030711

Pfam:Sulfotransfer_1 41 263 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106373
SMART Domains Protein: ENSMUSP00000101981
Gene: ENSMUSG00000030711

Pfam:Sulfotransfer_1 34 284 1.1e-89 PFAM
Pfam:Sulfotransfer_3 36 210 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123382
Predicted Effect probably benign
Transcript: ENSMUST00000129786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152231
Predicted Effect probably benign
Transcript: ENSMUST00000155419
SMART Domains Protein: ENSMUSP00000121514
Gene: ENSMUSG00000030711

Pfam:Sulfotransfer_1 34 121 6e-23 PFAM
Pfam:Sulfotransfer_1 133 181 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205507
AA Change: E108G

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000206359
AA Change: E108G

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1035 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCDC101 is a subunit of 2 histone acetyltransferase complexes: the ADA2A (TADA2A; MIM 602276)-containing (ATAC) complex and the SPT3 (SUPT3H; MIM 602947)-TAF9 (MIM 600822)-GCN5 (KAT2A; MIM 602301)/PCAF (KAT2B; MIM 602303) acetylase (STAGA) complex. Both of these complexes contain either GCN5 or PCAF, which are paralogous acetyltransferases (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Sgf29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Sgf29 APN 7 126664931 missense possibly damaging 0.94
IGL02546:Sgf29 APN 7 126671853 missense probably damaging 1.00
xiangfan UTSW 7 126663938 missense possibly damaging 0.90
R1438:Sgf29 UTSW 7 126671891 unclassified probably null
R1987:Sgf29 UTSW 7 126649477 splice site probably null
R4342:Sgf29 UTSW 7 126671777 missense probably damaging 1.00
R4489:Sgf29 UTSW 7 126663938 missense possibly damaging 0.90
R4869:Sgf29 UTSW 7 126649375 unclassified probably benign
R4928:Sgf29 UTSW 7 126664982 missense probably damaging 1.00
R7122:Sgf29 UTSW 7 126672049 missense probably null 0.44
R7319:Sgf29 UTSW 7 126671649 missense probably benign 0.00
R7902:Sgf29 UTSW 7 126672178 missense probably damaging 1.00
R7985:Sgf29 UTSW 7 126672178 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cccactttcctgacatctcac -3'
Posted On2013-05-23