Incidental Mutation 'R7354:Pcdhb22'
ID570848
Institutional Source Beutler Lab
Gene Symbol Pcdhb22
Ensembl Gene ENSMUSG00000073591
Gene Nameprotocadherin beta 22
SynonymsPcdhbV, Pcdhb15
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7354 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37517871-37524479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37520258 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 336 (D336G)
Ref Sequence ENSEMBL: ENSMUSP00000095214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000061405
SMART Domains Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Cadherin_2 30 110 4.2e-30 PFAM
CA 153 238 1.8e-17 SMART
CA 262 343 1.54e-25 SMART
CA 367 448 1.03e-21 SMART
CA 472 558 3.41e-27 SMART
CA 588 669 1.54e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097609
AA Change: D336G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591
AA Change: D336G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 28 110 5.8e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
Pfam:Cadherin_C_2 685 768 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192409
AA Change: D593G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591
AA Change: D593G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 27 110 2.5e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
transmembrane domain 689 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.5114 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,741,834 L724* probably null Het
5430419D17Rik G A 7: 131,256,729 C1042Y possibly damaging Het
5430419D17Rik G T 7: 131,272,033 C1696F unknown Het
Ago3 T A 4: 126,417,306 Q38L possibly damaging Het
Apon T A 10: 128,254,738 I95N probably benign Het
Arid1a G T 4: 133,693,947 P464Q unknown Het
Arid4b A G 13: 14,164,870 D503G probably benign Het
Asxl2 T C 12: 3,455,637 probably benign Het
Atp2a1 A T 7: 126,448,856 V594D probably damaging Het
Begain A G 12: 109,033,289 F519L possibly damaging Het
Bora A G 14: 99,047,358 T15A probably damaging Het
Btbd7 A T 12: 102,838,205 M192K probably benign Het
Ccdc125 T G 13: 100,677,874 probably null Het
Cfap74 G T 4: 155,465,347 V146L unknown Het
Crisp1 G A 17: 40,319,180 probably benign Het
Ctbp1 A T 5: 33,250,388 H292Q possibly damaging Het
Defb5 T A 8: 19,250,734 M34K probably benign Het
Dnajc27 A G 12: 4,096,249 I93V probably benign Het
Dqx1 T A 6: 83,060,976 Y448* probably null Het
Dynap A T 18: 70,241,300 C52S possibly damaging Het
Ehd4 C A 2: 120,102,132 R271L probably damaging Het
Ercc2 T G 7: 19,393,654 I619S possibly damaging Het
Etf1 A G 18: 34,905,987 I409T probably damaging Het
Fam117a A G 11: 95,380,703 D367G probably damaging Het
Fancd2 A G 6: 113,595,946 D1447G unknown Het
Fbxw9 T C 8: 85,062,196 S192P probably damaging Het
Frzb A T 2: 80,446,809 L11Q probably damaging Het
Gm14496 T C 2: 182,000,686 S717P probably damaging Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gm4353 C T 7: 116,083,911 R145Q probably benign Het
Gm765 T A 6: 98,238,281 D127V probably damaging Het
Gpr12 A T 5: 146,583,962 V50D probably damaging Het
Hes1 T C 16: 30,065,928 probably null Het
Hmcn1 A T 1: 150,806,445 C451* probably null Het
Iars T C 13: 49,704,320 V347A probably benign Het
Igfn1 A G 1: 135,976,032 S323P possibly damaging Het
Itga6 G A 2: 71,820,230 A207T probably damaging Het
Lgi4 T A 7: 31,060,622 L81H probably damaging Het
Lrp1 T C 10: 127,571,408 E1888G probably damaging Het
Man2a1 C T 17: 64,752,544 T1142M probably damaging Het
Mgam A T 6: 40,744,798 Y350F probably damaging Het
Miga1 T C 3: 152,290,500 D351G probably damaging Het
Mro A G 18: 73,873,314 T111A probably benign Het
Mtrr A T 13: 68,566,207 V471E probably damaging Het
Myh3 C A 11: 67,096,882 L1394I probably damaging Het
Myocd A G 11: 65,187,493 V492A probably benign Het
Nbeal2 A G 9: 110,629,179 F2115S probably damaging Het
Nlrp1b A T 11: 71,181,550 M489K possibly damaging Het
Olfr1228 T C 2: 89,248,687 probably null Het
Olfr128 A G 17: 37,924,393 I276V probably benign Het
Olfr1294 C T 2: 111,537,564 A242T possibly damaging Het
Olfr376 A T 11: 73,375,375 I212F probably benign Het
Olfr536 A C 7: 140,504,186 I91R probably damaging Het
Orc2 A G 1: 58,469,747 S462P possibly damaging Het
Pcdh9 T C 14: 93,888,270 T155A probably benign Het
Pcdhb16 G A 18: 37,478,124 V46I possibly damaging Het
Pde4dip T A 3: 97,719,330 R1297S probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Plxnb2 A G 15: 89,165,725 M531T possibly damaging Het
Poc5 T C 13: 96,394,525 V77A probably benign Het
Recql5 G A 11: 115,928,201 R180C probably damaging Het
Rho C A 6: 115,935,503 Y268* probably null Het
Riok1 A T 13: 38,047,312 H182L probably benign Het
Rnf207 T C 4: 152,314,091 D273G probably damaging Het
Serpinb11 A G 1: 107,377,533 Y213C probably benign Het
Slc16a10 T C 10: 40,076,955 Y181C probably damaging Het
Slc22a15 G A 3: 101,864,581 H401Y probably benign Het
Slc5a5 C A 8: 70,889,603 R268L probably damaging Het
Slc9a8 T C 2: 167,474,131 F576S possibly damaging Het
Slx4 T C 16: 3,987,099 E617G probably benign Het
Top1 T C 2: 160,704,958 I386T probably damaging Het
Tor1aip1 G T 1: 156,036,113 D41E probably damaging Het
Tsc22d4 G A 5: 137,768,109 R479Q probably benign Het
Unc79 C T 12: 103,142,702 T2191I possibly damaging Het
Vmn2r109 A T 17: 20,540,781 D771E probably damaging Het
Vmn2r82 A C 10: 79,356,630 M14L probably benign Het
Zc3h7a C T 16: 11,148,514 S583N probably damaging Het
Zfp518b G A 5: 38,682,779 probably benign Het
Zswim4 A G 8: 84,228,849 W314R probably damaging Het
Other mutations in Pcdhb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pcdhb22 APN 18 37520132 missense probably damaging 1.00
IGL00775:Pcdhb22 APN 18 37519742 missense probably benign 0.09
IGL01414:Pcdhb22 APN 18 37519496 missense probably damaging 1.00
IGL01819:Pcdhb22 APN 18 37519921 missense probably damaging 1.00
IGL02232:Pcdhb22 APN 18 37520549 missense probably damaging 1.00
IGL03226:Pcdhb22 APN 18 37518956 missense probably damaging 1.00
R0071:Pcdhb22 UTSW 18 37520078 missense probably damaging 1.00
R0363:Pcdhb22 UTSW 18 37519160 missense probably benign 0.01
R0454:Pcdhb22 UTSW 18 37518872 missense probably damaging 0.99
R0624:Pcdhb22 UTSW 18 37518727 missense probably benign 0.00
R0707:Pcdhb22 UTSW 18 37518851 missense probably damaging 1.00
R0918:Pcdhb22 UTSW 18 37520014 missense probably damaging 1.00
R1112:Pcdhb22 UTSW 18 37519768 missense possibly damaging 0.61
R1299:Pcdhb22 UTSW 18 37520590 missense probably damaging 0.99
R1351:Pcdhb22 UTSW 18 37518574 missense probably benign 0.10
R1488:Pcdhb22 UTSW 18 37519888 missense possibly damaging 0.79
R1595:Pcdhb22 UTSW 18 37520453 missense probably damaging 1.00
R1709:Pcdhb22 UTSW 18 37518500 missense probably benign 0.31
R1725:Pcdhb22 UTSW 18 37520188 missense probably benign 0.04
R1869:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1871:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1891:Pcdhb22 UTSW 18 37519304 missense probably damaging 0.97
R4523:Pcdhb22 UTSW 18 37520421 missense probably benign 0.05
R4825:Pcdhb22 UTSW 18 37520660 missense possibly damaging 0.80
R4831:Pcdhb22 UTSW 18 37520562 missense probably damaging 1.00
R4851:Pcdhb22 UTSW 18 37519034 missense possibly damaging 0.89
R4978:Pcdhb22 UTSW 18 37518601 missense probably benign 0.16
R5047:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5061:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5063:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5467:Pcdhb22 UTSW 18 37520135 missense probably benign 0.02
R6005:Pcdhb22 UTSW 18 37519736 missense possibly damaging 0.75
R6375:Pcdhb22 UTSW 18 37518304 intron probably benign
R6418:Pcdhb22 UTSW 18 37519906 missense possibly damaging 0.88
R6447:Pcdhb22 UTSW 18 37520216 missense possibly damaging 0.91
R6748:Pcdhb22 UTSW 18 37518746 missense probably damaging 0.99
R7195:Pcdhb22 UTSW 18 37519288 missense probably damaging 1.00
R7243:Pcdhb22 UTSW 18 37520632 missense probably benign 0.00
R7503:Pcdhb22 UTSW 18 37519102 missense probably benign 0.39
R7765:Pcdhb22 UTSW 18 37519105 missense probably damaging 0.99
R8201:Pcdhb22 UTSW 18 37518465 intron probably benign
X0027:Pcdhb22 UTSW 18 37520851 missense probably benign
Z1088:Pcdhb22 UTSW 18 37519345 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCATCTCCATCAACGCTGAC -3'
(R):5'- TCCACCATTAGCACCTGCAG -3'

Sequencing Primer
(F):5'- TGACAACGGGCAGCTGTTC -3'
(R):5'- ACCTGCAGTGTGACGCTAG -3'
Posted On2019-09-13