Incidental Mutation 'R7355:Slc25a54'
ID570862
Institutional Source Beutler Lab
Gene Symbol Slc25a54
Ensembl Gene ENSMUSG00000027880
Gene Namesolute carrier family 25, member 54
Synonyms4930443G12Rik, SCaMC-1like
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R7355 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location109080469-109116687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109102769 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 195 (W195R)
Ref Sequence ENSEMBL: ENSMUSP00000029478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029478] [ENSMUST00000159926]
Predicted Effect probably damaging
Transcript: ENSMUST00000029478
AA Change: W195R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029478
Gene: ENSMUSG00000027880
AA Change: W195R

DomainStartEndE-ValueType
EFh 23 51 4.28e0 SMART
EFh 59 87 3.82e0 SMART
EFh 90 118 4.12e-3 SMART
EFh 126 154 3.44e1 SMART
Pfam:Mito_carr 191 283 3.7e-25 PFAM
Pfam:Mito_carr 284 376 7.2e-24 PFAM
Pfam:Mito_carr 383 472 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159926
SMART Domains Protein: ENSMUSP00000124484
Gene: ENSMUSG00000027880

DomainStartEndE-ValueType
Blast:EFh 1 21 6e-9 BLAST
Pfam:Mito_carr 57 150 3.2e-26 PFAM
Pfam:Mito_carr 151 243 3.6e-25 PFAM
Pfam:Mito_carr 249 339 1.5e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,267,647 R1469W probably benign Het
Acad10 G T 5: 121,630,717 Y728* probably null Het
Adamts17 T C 7: 67,075,304 V160A Het
AI481877 T C 4: 59,076,155 D596G probably benign Het
Astn1 A T 1: 158,664,276 probably null Het
Atp8a2 T C 14: 60,045,004 K104E possibly damaging Het
Axl T C 7: 25,774,106 Y365C probably benign Het
Btbd16 A T 7: 130,821,443 Y409F probably benign Het
Caln1 A T 5: 130,414,891 T22S probably benign Het
Camk1 C A 6: 113,338,346 G164C probably damaging Het
Cd96 T C 16: 46,041,292 T512A possibly damaging Het
Ceacam5 A G 7: 17,747,387 D353G probably damaging Het
Cep162 C A 9: 87,253,955 E12* probably null Het
Cfh A T 1: 140,136,815 V365E probably damaging Het
Chd7 A G 4: 8,752,196 H231R unknown Het
Cntnap3 T C 13: 64,771,962 T694A probably benign Het
Colq C A 14: 31,545,109 G158V probably damaging Het
Ctif G A 18: 75,610,685 H139Y probably damaging Het
D630003M21Rik A T 2: 158,200,224 F934Y probably damaging Het
Dclre1a T A 19: 56,547,135 T6S possibly damaging Het
Dnmbp T C 19: 43,901,741 D529G probably benign Het
Fat2 T A 11: 55,256,551 Q3955L probably benign Het
Gjd4 A G 18: 9,280,860 S73P probably damaging Het
Gm14025 G T 2: 129,037,229 Q926K unknown Het
Gm19410 C A 8: 35,807,072 Q1460K probably benign Het
Golga5 A T 12: 102,472,235 I70F possibly damaging Het
Gon4l T A 3: 88,863,520 I502N probably damaging Het
Gtf2ird2 C G 5: 134,216,649 A583G probably benign Het
Hectd1 A C 12: 51,791,298 W694G possibly damaging Het
Ifit1bl2 C T 19: 34,619,661 G185D probably damaging Het
Igfbp6 G A 15: 102,147,940 A145T probably benign Het
Junb C T 8: 84,978,384 A16T probably benign Het
Kcnh4 C T 11: 100,752,443 V333I possibly damaging Het
Ly6c1 T C 15: 75,047,407 T45A possibly damaging Het
Mon2 T A 10: 123,009,516 Q1428L probably benign Het
Nfatc2ip C T 7: 126,387,611 probably null Het
Olfml3 C A 3: 103,736,079 G329W probably damaging Het
Olfr1012 C T 2: 85,753,679 P106L probably benign Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr118 A G 17: 37,672,410 Y129C probably benign Het
Olfr215 T A 6: 116,582,955 probably benign Het
Pcsk7 A G 9: 45,909,374 M35V probably benign Het
Phf14 A G 6: 12,081,007 N921S probably benign Het
Pla2g4e G A 2: 120,181,501 S396F possibly damaging Het
Ppp4r4 A T 12: 103,604,582 K766* probably null Het
Pprc1 T C 19: 46,065,346 V1105A unknown Het
Prdm9 T G 17: 15,545,235 N428H probably benign Het
Prkcg C T 7: 3,323,509 T497I possibly damaging Het
Prkcz A G 4: 155,357,496 W60R probably damaging Het
Ptprn2 T C 12: 116,858,951 F217L probably benign Het
Pum2 T A 12: 8,713,906 Y283* probably null Het
Rest A G 5: 77,268,028 M30V probably benign Het
Rfxank C T 8: 70,135,307 R150H probably damaging Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Sgk2 A G 2: 163,013,067 D366G probably benign Het
Siglec1 A T 2: 131,080,451 L568Q probably benign Het
Slain1 AT ATT 14: 103,702,576 probably null Het
Slc10a5 A T 3: 10,334,315 Y428* probably null Het
Slf1 A G 13: 77,091,303 I414T probably damaging Het
Snx4 C T 16: 33,266,866 P127L probably damaging Het
Spdl1 A T 11: 34,823,364 L166H not run Het
Tapt1 C T 5: 44,177,117 V511I probably benign Het
Tbata A G 10: 61,174,320 probably benign Het
Tbx4 T A 11: 85,912,009 V264E probably damaging Het
Tecta A T 9: 42,367,142 Y1023* probably null Het
Thop1 A G 10: 81,075,631 D117G probably damaging Het
Trip12 A G 1: 84,814,883 L13P probably damaging Het
Unc13b T A 4: 43,237,754 V637E probably damaging Het
Yipf3 T A 17: 46,250,640 M168K probably damaging Het
Zcchc6 T C 13: 59,821,802 N93S probably benign Het
Zfp119a A T 17: 55,866,287 C185* probably null Het
Zfyve21 A T 12: 111,825,051 I157F possibly damaging Het
Zfyve26 A T 12: 79,240,054 D2253E probably damaging Het
Other mutations in Slc25a54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Slc25a54 APN 3 109112860 missense possibly damaging 0.76
IGL02635:Slc25a54 APN 3 109112817 missense possibly damaging 0.71
IGL02944:Slc25a54 APN 3 109080615 missense probably benign 0.14
IGL02987:Slc25a54 APN 3 109116337 missense probably benign
IGL03346:Slc25a54 APN 3 109085730 intron probably benign
R0491:Slc25a54 UTSW 3 109102796 missense probably damaging 1.00
R0520:Slc25a54 UTSW 3 109107230 splice site probably benign
R0645:Slc25a54 UTSW 3 109112165 missense possibly damaging 0.70
R1803:Slc25a54 UTSW 3 109102697 missense probably benign
R1869:Slc25a54 UTSW 3 109080616 nonsense probably null
R1870:Slc25a54 UTSW 3 109080616 nonsense probably null
R3024:Slc25a54 UTSW 3 109080666 missense probably damaging 1.00
R3763:Slc25a54 UTSW 3 109112054 missense probably damaging 1.00
R3930:Slc25a54 UTSW 3 109116504 missense probably benign 0.03
R3941:Slc25a54 UTSW 3 109112163 missense probably damaging 1.00
R4346:Slc25a54 UTSW 3 109102739 missense possibly damaging 0.52
R4347:Slc25a54 UTSW 3 109102739 missense possibly damaging 0.52
R4445:Slc25a54 UTSW 3 109098668 missense probably benign 0.00
R4735:Slc25a54 UTSW 3 109098607 missense probably damaging 0.96
R4914:Slc25a54 UTSW 3 109111079 missense probably benign 0.34
R4960:Slc25a54 UTSW 3 109112816 missense possibly damaging 0.95
R5052:Slc25a54 UTSW 3 109102700 missense probably benign 0.03
R5106:Slc25a54 UTSW 3 109112864 missense probably benign 0.02
R5806:Slc25a54 UTSW 3 109080578 missense probably benign
R5936:Slc25a54 UTSW 3 109098638 missense possibly damaging 0.88
R6511:Slc25a54 UTSW 3 109094256 missense possibly damaging 0.92
R6532:Slc25a54 UTSW 3 109112052 missense probably damaging 1.00
R6879:Slc25a54 UTSW 3 109112834 missense possibly damaging 0.94
R7139:Slc25a54 UTSW 3 109098589 missense probably damaging 1.00
R7179:Slc25a54 UTSW 3 109107257 missense probably benign 0.00
R7282:Slc25a54 UTSW 3 109116501 nonsense probably null
R7336:Slc25a54 UTSW 3 109116435 missense probably benign 0.00
R7713:Slc25a54 UTSW 3 109102817 missense probably damaging 0.99
R8061:Slc25a54 UTSW 3 109111045 missense probably damaging 1.00
R8282:Slc25a54 UTSW 3 109098689 critical splice donor site probably null
Z1176:Slc25a54 UTSW 3 109112118 frame shift probably null
Z1177:Slc25a54 UTSW 3 109102797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCTTCAGTTTAGGAGGTGATCTG -3'
(R):5'- GGTACTAAGATATCTGCCAGGCAC -3'

Sequencing Primer
(F):5'- AAGAAATGTTGAGTTTTCCGTCTG -3'
(R):5'- GATATCTGCCAGGCACTTAAAATC -3'
Posted On2019-09-13