Mutagenetix > Incidental Mutation

Incidental Mutation 'R7355:Trip12'

570851

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7355 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84814883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 13 (L13P)

Ref Sequence

ENSEMBL: ENSMUSP00000140267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894] [ENSMUST00000187818] [ENSMUST00000189496] [ENSMUST00000190067]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: L13P

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000185909
AA Change: L13P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219
AA Change: L13P

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: L13P

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: L13P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: L13P

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186894
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: L13P

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000187818
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140917
Gene: ENSMUSG00000026219
AA Change: L13P

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000189496
AA Change: L13P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139682
Gene: ENSMUSG00000026219
AA Change: L13P

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000190067
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140817
Gene: ENSMUSG00000026219
AA Change: L13P

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,267,647	R1469W	probably benign	Het
Acad10	G	T	5: 121,630,717	Y728*	probably null	Het
Adamts17	T	C	7: 67,075,304	V160A		Het
AI481877	T	C	4: 59,076,155	D596G	probably benign	Het
Astn1	A	T	1: 158,664,276		probably null	Het
Atp8a2	T	C	14: 60,045,004	K104E	possibly damaging	Het
Axl	T	C	7: 25,774,106	Y365C	probably benign	Het
Btbd16	A	T	7: 130,821,443	Y409F	probably benign	Het
Caln1	A	T	5: 130,414,891	T22S	probably benign	Het
Camk1	C	A	6: 113,338,346	G164C	probably damaging	Het
Cd96	T	C	16: 46,041,292	T512A	possibly damaging	Het
Ceacam5	A	G	7: 17,747,387	D353G	probably damaging	Het
Cep162	C	A	9: 87,253,955	E12*	probably null	Het
Cfh	A	T	1: 140,136,815	V365E	probably damaging	Het
Chd7	A	G	4: 8,752,196	H231R	unknown	Het
Cntnap3	T	C	13: 64,771,962	T694A	probably benign	Het
Colq	C	A	14: 31,545,109	G158V	probably damaging	Het
Ctif	G	A	18: 75,610,685	H139Y	probably damaging	Het
D630003M21Rik	A	T	2: 158,200,224	F934Y	probably damaging	Het
Dclre1a	T	A	19: 56,547,135	T6S	possibly damaging	Het
Dnmbp	T	C	19: 43,901,741	D529G	probably benign	Het
Fat2	T	A	11: 55,256,551	Q3955L	probably benign	Het
Gjd4	A	G	18: 9,280,860	S73P	probably damaging	Het
Gm14025	G	T	2: 129,037,229	Q926K	unknown	Het
Gm19410	C	A	8: 35,807,072	Q1460K	probably benign	Het
Golga5	A	T	12: 102,472,235	I70F	possibly damaging	Het
Gon4l	T	A	3: 88,863,520	I502N	probably damaging	Het
Gtf2ird2	C	G	5: 134,216,649	A583G	probably benign	Het
Hectd1	A	C	12: 51,791,298	W694G	possibly damaging	Het
Ifit1bl2	C	T	19: 34,619,661	G185D	probably damaging	Het
Igfbp6	G	A	15: 102,147,940	A145T	probably benign	Het
Junb	C	T	8: 84,978,384	A16T	probably benign	Het
Kcnh4	C	T	11: 100,752,443	V333I	possibly damaging	Het
Ly6c1	T	C	15: 75,047,407	T45A	possibly damaging	Het
Mon2	T	A	10: 123,009,516	Q1428L	probably benign	Het
Nfatc2ip	C	T	7: 126,387,611		probably null	Het
Olfml3	C	A	3: 103,736,079	G329W	probably damaging	Het
Olfr1012	C	T	2: 85,753,679	P106L	probably benign	Het
Olfr1118	T	C	2: 87,309,410	V207A	probably benign	Het
Olfr118	A	G	17: 37,672,410	Y129C	probably benign	Het
Olfr215	T	A	6: 116,582,955		probably benign	Het
Pcsk7	A	G	9: 45,909,374	M35V	probably benign	Het
Phf14	A	G	6: 12,081,007	N921S	probably benign	Het
Pla2g4e	G	A	2: 120,181,501	S396F	possibly damaging	Het
Ppp4r4	A	T	12: 103,604,582	K766*	probably null	Het
Pprc1	T	C	19: 46,065,346	V1105A	unknown	Het
Prdm9	T	G	17: 15,545,235	N428H	probably benign	Het
Prkcg	C	T	7: 3,323,509	T497I	possibly damaging	Het
Prkcz	A	G	4: 155,357,496	W60R	probably damaging	Het
Ptprn2	T	C	12: 116,858,951	F217L	probably benign	Het
Pum2	T	A	12: 8,713,906	Y283*	probably null	Het
Rest	A	G	5: 77,268,028	M30V	probably benign	Het
Rfxank	C	T	8: 70,135,307	R150H	probably damaging	Het
Ros1	T	A	10: 52,166,079	Q250L	probably damaging	Het
Sgk2	A	G	2: 163,013,067	D366G	probably benign	Het
Siglec1	A	T	2: 131,080,451	L568Q	probably benign	Het
Slain1	AT	ATT	14: 103,702,576		probably null	Het
Slc10a5	A	T	3: 10,334,315	Y428*	probably null	Het
Slc25a54	T	C	3: 109,102,769	W195R	probably damaging	Het
Slf1	A	G	13: 77,091,303	I414T	probably damaging	Het
Snx4	C	T	16: 33,266,866	P127L	probably damaging	Het
Spdl1	A	T	11: 34,823,364	L166H	not run	Het
Tapt1	C	T	5: 44,177,117	V511I	probably benign	Het
Tbata	A	G	10: 61,174,320		probably benign	Het
Tbx4	T	A	11: 85,912,009	V264E	probably damaging	Het
Tecta	A	T	9: 42,367,142	Y1023*	probably null	Het
Thop1	A	G	10: 81,075,631	D117G	probably damaging	Het
Unc13b	T	A	4: 43,237,754	V637E	probably damaging	Het
Yipf3	T	A	17: 46,250,640	M168K	probably damaging	Het
Zcchc6	T	C	13: 59,821,802	N93S	probably benign	Het
Zfp119a	A	T	17: 55,866,287	C185*	probably null	Het
Zfyve21	A	T	12: 111,825,051	I157F	possibly damaging	Het
Zfyve26	A	T	12: 79,240,054	D2253E	probably damaging	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAACTAATTTTAGTGGGGTCTACG -3'
(R):5'- ATCCACAGTCCAGTTACATAGTG -3'

Sequencing Primer
(F):5'- CCATGTTTTGGTCCTCATAATGAG -3'
(R):5'- GTGTAATAAGGCAATACACCTTGC -3'

Posted On

2019-09-13