Incidental Mutation 'R7355:Trip12'
ID570851
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Namethyroid hormone receptor interactor 12
Synonyms6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7355 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location84721189-84840516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84814883 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 13 (L13P)
Ref Sequence ENSEMBL: ENSMUSP00000140267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894] [ENSMUST00000187818] [ENSMUST00000189496] [ENSMUST00000190067]
Predicted Effect probably damaging
Transcript: ENSMUST00000027421
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: L13P

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185909
AA Change: L13P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219
AA Change: L13P

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186465
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: L13P

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186648
AA Change: L13P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: L13P

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186894
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: L13P

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 3e-20 SMART
PDB:1WA5|B 447 641 7e-6 PDB
Blast:ARM 476 516 6e-6 BLAST
WWE 764 839 6.9e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187818
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140917
Gene: ENSMUSG00000026219
AA Change: L13P

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189496
AA Change: L13P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139682
Gene: ENSMUSG00000026219
AA Change: L13P

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190067
AA Change: L13P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140817
Gene: ENSMUSG00000026219
AA Change: L13P

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,267,647 R1469W probably benign Het
Acad10 G T 5: 121,630,717 Y728* probably null Het
Adamts17 T C 7: 67,075,304 V160A Het
AI481877 T C 4: 59,076,155 D596G probably benign Het
Astn1 A T 1: 158,664,276 probably null Het
Atp8a2 T C 14: 60,045,004 K104E possibly damaging Het
Axl T C 7: 25,774,106 Y365C probably benign Het
Btbd16 A T 7: 130,821,443 Y409F probably benign Het
Caln1 A T 5: 130,414,891 T22S probably benign Het
Camk1 C A 6: 113,338,346 G164C probably damaging Het
Cd96 T C 16: 46,041,292 T512A possibly damaging Het
Ceacam5 A G 7: 17,747,387 D353G probably damaging Het
Cep162 C A 9: 87,253,955 E12* probably null Het
Cfh A T 1: 140,136,815 V365E probably damaging Het
Chd7 A G 4: 8,752,196 H231R unknown Het
Cntnap3 T C 13: 64,771,962 T694A probably benign Het
Colq C A 14: 31,545,109 G158V probably damaging Het
Ctif G A 18: 75,610,685 H139Y probably damaging Het
D630003M21Rik A T 2: 158,200,224 F934Y probably damaging Het
Dclre1a T A 19: 56,547,135 T6S possibly damaging Het
Dnmbp T C 19: 43,901,741 D529G probably benign Het
Fat2 T A 11: 55,256,551 Q3955L probably benign Het
Gjd4 A G 18: 9,280,860 S73P probably damaging Het
Gm14025 G T 2: 129,037,229 Q926K unknown Het
Gm19410 C A 8: 35,807,072 Q1460K probably benign Het
Golga5 A T 12: 102,472,235 I70F possibly damaging Het
Gon4l T A 3: 88,863,520 I502N probably damaging Het
Gtf2ird2 C G 5: 134,216,649 A583G probably benign Het
Hectd1 A C 12: 51,791,298 W694G possibly damaging Het
Ifit1bl2 C T 19: 34,619,661 G185D probably damaging Het
Igfbp6 G A 15: 102,147,940 A145T probably benign Het
Junb C T 8: 84,978,384 A16T probably benign Het
Kcnh4 C T 11: 100,752,443 V333I possibly damaging Het
Ly6c1 T C 15: 75,047,407 T45A possibly damaging Het
Mon2 T A 10: 123,009,516 Q1428L probably benign Het
Nfatc2ip C T 7: 126,387,611 probably null Het
Olfml3 C A 3: 103,736,079 G329W probably damaging Het
Olfr1012 C T 2: 85,753,679 P106L probably benign Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr118 A G 17: 37,672,410 Y129C probably benign Het
Olfr215 T A 6: 116,582,955 probably benign Het
Pcsk7 A G 9: 45,909,374 M35V probably benign Het
Phf14 A G 6: 12,081,007 N921S probably benign Het
Pla2g4e G A 2: 120,181,501 S396F possibly damaging Het
Ppp4r4 A T 12: 103,604,582 K766* probably null Het
Pprc1 T C 19: 46,065,346 V1105A unknown Het
Prdm9 T G 17: 15,545,235 N428H probably benign Het
Prkcg C T 7: 3,323,509 T497I possibly damaging Het
Prkcz A G 4: 155,357,496 W60R probably damaging Het
Ptprn2 T C 12: 116,858,951 F217L probably benign Het
Pum2 T A 12: 8,713,906 Y283* probably null Het
Rest A G 5: 77,268,028 M30V probably benign Het
Rfxank C T 8: 70,135,307 R150H probably damaging Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Sgk2 A G 2: 163,013,067 D366G probably benign Het
Siglec1 A T 2: 131,080,451 L568Q probably benign Het
Slain1 AT ATT 14: 103,702,576 probably null Het
Slc10a5 A T 3: 10,334,315 Y428* probably null Het
Slc25a54 T C 3: 109,102,769 W195R probably damaging Het
Slf1 A G 13: 77,091,303 I414T probably damaging Het
Snx4 C T 16: 33,266,866 P127L probably damaging Het
Spdl1 A T 11: 34,823,364 L166H not run Het
Tapt1 C T 5: 44,177,117 V511I probably benign Het
Tbata A G 10: 61,174,320 probably benign Het
Tbx4 T A 11: 85,912,009 V264E probably damaging Het
Tecta A T 9: 42,367,142 Y1023* probably null Het
Thop1 A G 10: 81,075,631 D117G probably damaging Het
Unc13b T A 4: 43,237,754 V637E probably damaging Het
Yipf3 T A 17: 46,250,640 M168K probably damaging Het
Zcchc6 T C 13: 59,821,802 N93S probably benign Het
Zfp119a A T 17: 55,866,287 C185* probably null Het
Zfyve21 A T 12: 111,825,051 I157F possibly damaging Het
Zfyve26 A T 12: 79,240,054 D2253E probably damaging Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
Turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
R7361:Trip12 UTSW 1 84750442 missense probably damaging 0.98
R7588:Trip12 UTSW 1 84760883 missense probably damaging 0.99
R7705:Trip12 UTSW 1 84777449 missense probably damaging 1.00
R7818:Trip12 UTSW 1 84760806 missense probably damaging 1.00
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTAATTTTAGTGGGGTCTACG -3'
(R):5'- ATCCACAGTCCAGTTACATAGTG -3'

Sequencing Primer
(F):5'- CCATGTTTTGGTCCTCATAATGAG -3'
(R):5'- GTGTAATAAGGCAATACACCTTGC -3'
Posted On2019-09-13