Incidental Mutation 'R7355:Olfr118'
ID570913
Institutional Source Beutler Lab
Gene Symbol Olfr118
Ensembl Gene ENSMUSG00000080990
Gene Nameolfactory receptor 118
SynonymsMOR263-13, GA_x6K02T2PSCP-2131124-2132089
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7355 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37666988-37673476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37672410 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 129 (Y129C)
Ref Sequence ENSEMBL: ENSMUSP00000150176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]
Predicted Effect probably benign
Transcript: ENSMUST00000122036
AA Change: Y129C

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: Y129C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 32 173 2e-6 PFAM
Pfam:7tm_4 37 314 2.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 41 311 5.8e-6 PFAM
Pfam:7tm_1 47 296 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215811
AA Change: Y129C

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216551
AA Change: Y129C

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,267,647 R1469W probably benign Het
Acad10 G T 5: 121,630,717 Y728* probably null Het
Adamts17 T C 7: 67,075,304 V160A Het
AI481877 T C 4: 59,076,155 D596G probably benign Het
Astn1 A T 1: 158,664,276 probably null Het
Atp8a2 T C 14: 60,045,004 K104E possibly damaging Het
Axl T C 7: 25,774,106 Y365C probably benign Het
Btbd16 A T 7: 130,821,443 Y409F probably benign Het
Caln1 A T 5: 130,414,891 T22S probably benign Het
Camk1 C A 6: 113,338,346 G164C probably damaging Het
Cd96 T C 16: 46,041,292 T512A possibly damaging Het
Ceacam5 A G 7: 17,747,387 D353G probably damaging Het
Cep162 C A 9: 87,253,955 E12* probably null Het
Cfh A T 1: 140,136,815 V365E probably damaging Het
Chd7 A G 4: 8,752,196 H231R unknown Het
Cntnap3 T C 13: 64,771,962 T694A probably benign Het
Colq C A 14: 31,545,109 G158V probably damaging Het
Ctif G A 18: 75,610,685 H139Y probably damaging Het
D630003M21Rik A T 2: 158,200,224 F934Y probably damaging Het
Dclre1a T A 19: 56,547,135 T6S possibly damaging Het
Dnmbp T C 19: 43,901,741 D529G probably benign Het
Fat2 T A 11: 55,256,551 Q3955L probably benign Het
Gjd4 A G 18: 9,280,860 S73P probably damaging Het
Gm14025 G T 2: 129,037,229 Q926K unknown Het
Gm19410 C A 8: 35,807,072 Q1460K probably benign Het
Golga5 A T 12: 102,472,235 I70F possibly damaging Het
Gon4l T A 3: 88,863,520 I502N probably damaging Het
Gtf2ird2 C G 5: 134,216,649 A583G probably benign Het
Hectd1 A C 12: 51,791,298 W694G possibly damaging Het
Ifit1bl2 C T 19: 34,619,661 G185D probably damaging Het
Igfbp6 G A 15: 102,147,940 A145T probably benign Het
Junb C T 8: 84,978,384 A16T probably benign Het
Kcnh4 C T 11: 100,752,443 V333I possibly damaging Het
Ly6c1 T C 15: 75,047,407 T45A possibly damaging Het
Mon2 T A 10: 123,009,516 Q1428L probably benign Het
Nfatc2ip C T 7: 126,387,611 probably null Het
Olfml3 C A 3: 103,736,079 G329W probably damaging Het
Olfr1012 C T 2: 85,753,679 P106L probably benign Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr215 T A 6: 116,582,955 probably benign Het
Pcsk7 A G 9: 45,909,374 M35V probably benign Het
Phf14 A G 6: 12,081,007 N921S probably benign Het
Pla2g4e G A 2: 120,181,501 S396F possibly damaging Het
Ppp4r4 A T 12: 103,604,582 K766* probably null Het
Pprc1 T C 19: 46,065,346 V1105A unknown Het
Prdm9 T G 17: 15,545,235 N428H probably benign Het
Prkcg C T 7: 3,323,509 T497I possibly damaging Het
Prkcz A G 4: 155,357,496 W60R probably damaging Het
Ptprn2 T C 12: 116,858,951 F217L probably benign Het
Pum2 T A 12: 8,713,906 Y283* probably null Het
Rest A G 5: 77,268,028 M30V probably benign Het
Rfxank C T 8: 70,135,307 R150H probably damaging Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Sgk2 A G 2: 163,013,067 D366G probably benign Het
Siglec1 A T 2: 131,080,451 L568Q probably benign Het
Slain1 AT ATT 14: 103,702,576 probably null Het
Slc10a5 A T 3: 10,334,315 Y428* probably null Het
Slc25a54 T C 3: 109,102,769 W195R probably damaging Het
Slf1 A G 13: 77,091,303 I414T probably damaging Het
Snx4 C T 16: 33,266,866 P127L probably damaging Het
Spdl1 A T 11: 34,823,364 L166H not run Het
Tapt1 C T 5: 44,177,117 V511I probably benign Het
Tbata A G 10: 61,174,320 probably benign Het
Tbx4 T A 11: 85,912,009 V264E probably damaging Het
Tecta A T 9: 42,367,142 Y1023* probably null Het
Thop1 A G 10: 81,075,631 D117G probably damaging Het
Trip12 A G 1: 84,814,883 L13P probably damaging Het
Unc13b T A 4: 43,237,754 V637E probably damaging Het
Yipf3 T A 17: 46,250,640 M168K probably damaging Het
Zcchc6 T C 13: 59,821,802 N93S probably benign Het
Zfp119a A T 17: 55,866,287 C185* probably null Het
Zfyve21 A T 12: 111,825,051 I157F possibly damaging Het
Zfyve26 A T 12: 79,240,054 D2253E probably damaging Het
Other mutations in Olfr118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Olfr118 APN 17 37672887 missense probably damaging 1.00
IGL02456:Olfr118 APN 17 37672449 missense possibly damaging 0.90
IGL02750:Olfr118 APN 17 37672609 nonsense probably null
IGL03083:Olfr118 APN 17 37672660 nonsense probably null
IGL03339:Olfr118 APN 17 37672557 missense possibly damaging 0.87
R0032:Olfr118 UTSW 17 37672487 missense probably damaging 1.00
R1457:Olfr118 UTSW 17 37672925 nonsense probably null
R1542:Olfr118 UTSW 17 37672251 missense probably damaging 1.00
R1771:Olfr118 UTSW 17 37672663 missense probably damaging 1.00
R1893:Olfr118 UTSW 17 37672856 nonsense probably null
R2395:Olfr118 UTSW 17 37672696 nonsense probably null
R3619:Olfr118 UTSW 17 37672640 missense probably benign 0.05
R3917:Olfr118 UTSW 17 37672793 missense probably damaging 1.00
R3937:Olfr118 UTSW 17 37672967 missense probably benign 0.01
R5600:Olfr118 UTSW 17 37672285 missense possibly damaging 0.91
R6415:Olfr118 UTSW 17 37672557 missense possibly damaging 0.87
R6462:Olfr118 UTSW 17 37672220 missense probably damaging 1.00
R7861:Olfr118 UTSW 17 37672517 missense possibly damaging 0.91
R7913:Olfr118 UTSW 17 37672108 missense probably benign
R7952:Olfr118 UTSW 17 37672817 missense probably damaging 1.00
R7969:Olfr118 UTSW 17 37672656 missense probably damaging 1.00
RF003:Olfr118 UTSW 17 37672858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACTTGTCTCTCCTGGAG -3'
(R):5'- GCCTCATTTTGGGATGTATCGC -3'

Sequencing Primer
(F):5'- TCCTGGAGATCGGCTACACTTG -3'
(R):5'- TTGGGATGTATCGCCACAAGC -3'
Posted On2019-09-13