Incidental Mutation 'R7362:Mkln1'
ID 571408
Institutional Source Beutler Lab
Gene Symbol Mkln1
Ensembl Gene ENSMUSG00000025609
Gene Name muskelin 1, intracellular mediator containing kelch motifs
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R7362 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 31398735-31516811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31468168 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 333 (I333T)
Ref Sequence ENSEMBL: ENSMUSP00000026699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026699]
AlphaFold O89050
PDB Structure The crystal structure of discoidin domain from muskelin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026699
AA Change: I333T

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026699
Gene: ENSMUSG00000025609
AA Change: I333T

DomainStartEndE-ValueType
Pfam:F5_F8_type_C 20 150 5.8e-11 PFAM
LisH 172 204 4.68e-3 SMART
CTLH 206 258 5.29e-2 SMART
Pfam:Kelch_4 270 324 5.8e-7 PFAM
Pfam:Kelch_1 279 315 2.2e-8 PFAM
Pfam:Kelch_3 282 334 7.6e-13 PFAM
Pfam:Kelch_1 459 498 2.8e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal high-frequency ripple oscillation associated with GABA receptor internalization, intracellular trafficking, and degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,292,997 Q1393L possibly damaging Het
Adprhl1 C T 8: 13,245,534 R193K probably damaging Het
Aoc1 G T 6: 48,905,411 V74L probably benign Het
Bfsp1 G C 2: 143,826,875 P601A probably benign Het
Bicd1 A C 6: 149,484,093 K108T probably benign Het
Btbd18 C T 2: 84,661,543 Q23* probably null Het
Ccser1 A G 6: 61,810,880 I227M unknown Het
Cd151 G A 7: 141,469,589 V70I probably benign Het
Cdh10 A G 15: 18,899,694 T36A probably benign Het
Crb2 A G 2: 37,790,199 T380A probably benign Het
Csmd3 A C 15: 47,755,992 S1829A possibly damaging Het
Dgat2 A T 7: 99,154,636 H359Q probably damaging Het
Dhdds T C 4: 133,971,130 T298A probably benign Het
Egfem1 A G 3: 29,151,920 Q102R probably benign Het
Eps15 T A 4: 109,366,242 probably null Het
Ern1 T A 11: 106,437,123 D61V probably damaging Het
Fcamr G A 1: 130,814,023 R511Q possibly damaging Het
Grhpr T C 4: 44,987,255 V213A probably benign Het
Gsx2 A G 5: 75,076,104 D115G possibly damaging Het
Hoxd3 A G 2: 74,744,219 I70V possibly damaging Het
Inpp5a A G 7: 139,578,380 I408V probably benign Het
Kansl3 A T 1: 36,344,127 D759E possibly damaging Het
Lrrc37a T G 11: 103,457,509 T2787P unknown Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Myt1 T A 2: 181,797,240 V227D probably benign Het
Olfr403 T C 11: 74,195,586 F28L probably benign Het
Olfr593 T A 7: 103,212,654 Y265N probably damaging Het
Olfr863-ps1 C T 9: 19,942,231 D70N probably damaging Het
Pcf11 A G 7: 92,653,245 L1219P possibly damaging Het
Pde6g T C 11: 120,448,124 E80G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp3cb T A 14: 20,523,651 Q304L probably benign Het
Prr19 T C 7: 25,303,918 L319P probably damaging Het
Prss23 C T 7: 89,509,764 A366T probably damaging Het
Rock2 T C 12: 16,958,421 L560P probably damaging Het
Simc1 A T 13: 54,539,704 R95S probably damaging Het
Slc10a6 A T 5: 103,629,126 V36E probably damaging Het
Slco1c1 A T 6: 141,569,463 T695S probably benign Het
Ssh2 T C 11: 77,449,650 F543L probably benign Het
Tecpr2 T A 12: 110,941,476 V999D possibly damaging Het
Tnfsf10 A T 3: 27,335,348 Y186F probably damaging Het
Tnk2 A T 16: 32,675,520 probably null Het
Tram1 T C 1: 13,589,608 M39V probably benign Het
Uck2 C T 1: 167,237,642 V36I possibly damaging Het
Ugcg T A 4: 59,217,109 M211K probably damaging Het
Vash2 A T 1: 190,960,299 S226R probably damaging Het
Vmn1r172 T A 7: 23,660,416 M242K probably damaging Het
Vmn2r82 A T 10: 79,396,617 M817L probably benign Het
Vwa5b1 T C 4: 138,594,312 N390S probably damaging Het
Wdr73 T A 7: 80,900,703 D17V probably damaging Het
Wdr91 A T 6: 34,889,115 S501T possibly damaging Het
Zfp454 A G 11: 50,886,367 probably null Het
Other mutations in Mkln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Mkln1 APN 6 31432990 missense probably damaging 0.99
IGL01569:Mkln1 APN 6 31428128 splice site probably benign
IGL01882:Mkln1 APN 6 31451534 missense probably benign
IGL02009:Mkln1 APN 6 31449520 missense probably benign 0.02
IGL02160:Mkln1 APN 6 31492791 splice site probably benign
IGL02994:Mkln1 APN 6 31490443 missense probably damaging 1.00
IGL03105:Mkln1 APN 6 31459059 nonsense probably null
PIT4377001:Mkln1 UTSW 6 31474354 missense probably damaging 1.00
R0376:Mkln1 UTSW 6 31478018 missense probably benign 0.00
R0446:Mkln1 UTSW 6 31449504 missense probably damaging 0.98
R0518:Mkln1 UTSW 6 31468132 missense probably benign 0.00
R0600:Mkln1 UTSW 6 31432927 splice site probably benign
R1066:Mkln1 UTSW 6 31418987 missense possibly damaging 0.85
R1248:Mkln1 UTSW 6 31489368 missense probably damaging 1.00
R1717:Mkln1 UTSW 6 31507644 missense probably benign
R1921:Mkln1 UTSW 6 31428178 missense probably benign 0.22
R1978:Mkln1 UTSW 6 31490530 nonsense probably null
R3836:Mkln1 UTSW 6 31468336 missense probably damaging 1.00
R3895:Mkln1 UTSW 6 31507667 missense probably damaging 1.00
R4456:Mkln1 UTSW 6 31426772 missense probably damaging 1.00
R4513:Mkln1 UTSW 6 31433158 intron probably benign
R4737:Mkln1 UTSW 6 31426799 missense probably damaging 1.00
R4819:Mkln1 UTSW 6 31474486 missense probably benign 0.00
R4960:Mkln1 UTSW 6 31459006 missense probably damaging 1.00
R5291:Mkln1 UTSW 6 31490481 missense possibly damaging 0.78
R5364:Mkln1 UTSW 6 31496712 missense probably damaging 1.00
R5739:Mkln1 UTSW 6 31496702 missense probably benign 0.00
R5797:Mkln1 UTSW 6 31433069 missense probably benign 0.21
R5890:Mkln1 UTSW 6 31490547 missense probably benign 0.02
R5940:Mkln1 UTSW 6 31489372 missense probably damaging 1.00
R6132:Mkln1 UTSW 6 31431220 missense probably damaging 0.98
R6521:Mkln1 UTSW 6 31490544 missense probably damaging 1.00
R7711:Mkln1 UTSW 6 31492649 missense probably damaging 0.99
R8094:Mkln1 UTSW 6 31492653 nonsense probably null
R8340:Mkln1 UTSW 6 31432943 missense possibly damaging 0.53
R8379:Mkln1 UTSW 6 31458965 nonsense probably null
R8972:Mkln1 UTSW 6 31496746 missense probably damaging 1.00
R9403:Mkln1 UTSW 6 31432970 missense probably damaging 1.00
Z1176:Mkln1 UTSW 6 31398921 missense possibly damaging 0.74
Z1176:Mkln1 UTSW 6 31451554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAAAGTTTGTGTCTCCCACTG -3'
(R):5'- GAGCAAAGGTCACTCAGCAC -3'

Sequencing Primer
(F):5'- AAGTTTGTGTCTCCCACTGATACTTC -3'
(R):5'- GGTCACTCAGCACTATTAACTCTAC -3'
Posted On 2019-09-13