Incidental Mutation 'R6478:Hectd3'
ID 516897
Institutional Source Beutler Lab
Gene Symbol Hectd3
Ensembl Gene ENSMUSG00000046861
Gene Name HECT domain E3 ubiquitin protein ligase 3
Synonyms 1700064K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6478 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 116995317-117005277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 116999586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 443 (K443N)
Ref Sequence ENSEMBL: ENSMUSP00000051922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050067]
AlphaFold Q3U487
Predicted Effect probably damaging
Transcript: ENSMUST00000050067
AA Change: K443N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051922
Gene: ENSMUSG00000046861
AA Change: K443N

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
APC10 237 391 6.75e-23 SMART
HECTc 514 857 1.27e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155267
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,332 V306A possibly damaging Het
9530053A07Rik C G 7: 28,155,373 P1808R probably damaging Het
Aatk T A 11: 120,010,991 S803C probably benign Het
Abcc9 C T 6: 142,679,308 A454T probably damaging Het
Abr T C 11: 76,452,332 E565G probably damaging Het
Adam33 C A 2: 131,051,346 R753L probably benign Het
Adgre1 A G 17: 57,401,955 T49A possibly damaging Het
AI314180 A T 4: 58,810,785 I1524N probably damaging Het
Ankra2 A T 13: 98,268,442 H153L probably damaging Het
Ankrd26 T G 6: 118,511,638 E1353D probably benign Het
Ankrd52 T G 10: 128,379,331 probably null Het
Arhgef10l T A 4: 140,542,757 T619S possibly damaging Het
Asgr1 T C 11: 70,056,894 V130A possibly damaging Het
Atg10 C A 13: 90,937,347 C161F probably damaging Het
Atm A T 9: 53,490,254 N1438K probably damaging Het
BC107364 T A 3: 96,436,006 probably null Het
Bcar3 G T 3: 122,426,576 A41S probably benign Het
Btbd6 A G 12: 112,977,312 probably benign Het
Cchcr1 A G 17: 35,524,703 T318A possibly damaging Het
Celsr1 A T 15: 85,925,518 I2221N probably damaging Het
Cept1 C T 3: 106,533,445 W48* probably null Het
Cfap161 T A 7: 83,793,276 I85L probably benign Het
Clasp1 A T 1: 118,512,180 R640* probably null Het
Col5a1 T A 2: 27,952,436 I441N unknown Het
Col9a1 C A 1: 24,185,405 L223I unknown Het
Dnah2 T C 11: 69,516,010 D223G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpy19l1 A T 9: 24,450,696 M129K possibly damaging Het
Fcrl1 C A 3: 87,389,639 H318Q probably benign Het
Fer1l5 A G 1: 36,402,531 N609S probably damaging Het
Fkbp4 C T 6: 128,433,231 E256K probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Glrx G A 13: 75,847,299 probably null Het
Gm6614 A T 6: 141,993,642 N208K possibly damaging Het
Gm7356 A T 17: 14,001,464 M101K probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Hmcn1 T A 1: 150,664,784 R2925W probably damaging Het
Hspa1a G T 17: 34,970,306 N540K probably damaging Het
Ints6 A T 14: 62,700,786 M649K probably benign Het
Katnb1 T C 8: 95,095,456 V270A possibly damaging Het
Kctd3 A G 1: 188,972,364 S737P probably benign Het
Klra10 T C 6: 130,272,544 probably null Het
Lmtk3 A G 7: 45,798,589 D1353G unknown Het
Lrrk1 A G 7: 66,262,733 V1693A probably damaging Het
Mpnd A T 17: 56,009,575 I85F probably damaging Het
Myo3b A G 2: 70,348,960 T1173A probably benign Het
Myof G A 19: 37,903,831 P1158L probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ncor2 A G 5: 125,110,005 probably benign Het
Npepps C T 11: 97,258,273 probably null Het
Olfr1247 T G 2: 89,609,446 I219L probably damaging Het
Opn5 T A 17: 42,580,749 I266F probably benign Het
P2rx4 A G 5: 122,707,700 D16G probably damaging Het
Padi2 G T 4: 140,917,637 V61L probably benign Het
Pkd1l1 G A 11: 8,863,911 T1480I probably benign Het
Plcb1 T C 2: 135,335,451 S568P probably damaging Het
Rassf10 A G 7: 112,955,707 E505G probably damaging Het
Rcan2 A G 17: 43,836,334 E21G probably benign Het
Rhob G T 12: 8,499,585 C16* probably null Het
Ryr3 T C 2: 112,660,068 N3807S probably damaging Het
Sass6 T A 3: 116,621,397 N519K probably benign Het
Smad9 A T 3: 54,782,443 D28V probably damaging Het
Tepp A T 8: 95,321,266 probably null Het
Tex14 G T 11: 87,514,373 G704C probably benign Het
Tmc3 A G 7: 83,622,316 N892S probably benign Het
Tnfaip2 T A 12: 111,445,663 L166Q probably damaging Het
Triml2 A G 8: 43,185,128 probably null Het
Trio A G 15: 27,856,107 V666A probably benign Het
Tshz2 G T 2: 169,884,664 L393F probably damaging Het
Ttn T G 2: 76,841,771 probably benign Het
Tubb5 A G 17: 35,835,842 Y159H probably damaging Het
Umodl1 A G 17: 30,959,155 Y35C probably damaging Het
Utp4 T C 8: 106,904,446 probably null Het
Vmn1r60 A T 7: 5,544,865 C79S probably damaging Het
Wnt5b T C 6: 119,433,790 T230A probably damaging Het
Zfp618 A T 4: 63,132,706 I575F probably damaging Het
Zmym6 G T 4: 127,123,383 V894L possibly damaging Het
Zpbp T C 11: 11,462,318 probably benign Het
Other mutations in Hectd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Hectd3 APN 4 117000588 splice site probably benign
IGL00227:Hectd3 APN 4 117000587 splice site probably benign
IGL00227:Hectd3 APN 4 117000589 splice site probably benign
IGL00987:Hectd3 APN 4 116999643 missense probably damaging 0.98
IGL01402:Hectd3 APN 4 116996065 missense probably damaging 0.96
IGL01660:Hectd3 APN 4 116996372 missense possibly damaging 0.91
IGL02397:Hectd3 APN 4 117003136 missense possibly damaging 0.94
IGL03029:Hectd3 APN 4 116996965 nonsense probably null
chopstix2 UTSW 4 116996396 missense probably benign 0.08
R0147:Hectd3 UTSW 4 116997040 unclassified probably benign
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0611:Hectd3 UTSW 4 116996044 missense possibly damaging 0.67
R1367:Hectd3 UTSW 4 116997170 missense probably null 0.48
R1401:Hectd3 UTSW 4 117002269 missense possibly damaging 0.52
R1444:Hectd3 UTSW 4 116996396 missense probably benign 0.08
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1517:Hectd3 UTSW 4 117002994 missense probably damaging 0.96
R1584:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1593:Hectd3 UTSW 4 116997020 missense possibly damaging 0.86
R1628:Hectd3 UTSW 4 116997392 missense probably damaging 1.00
R1669:Hectd3 UTSW 4 116999643 missense probably damaging 0.98
R1731:Hectd3 UTSW 4 116996455 critical splice donor site probably null
R1918:Hectd3 UTSW 4 117000343 missense possibly damaging 0.68
R2029:Hectd3 UTSW 4 117000685 missense probably damaging 0.99
R2174:Hectd3 UTSW 4 116999701 missense probably benign 0.04
R2184:Hectd3 UTSW 4 117000903 missense possibly damaging 0.93
R2226:Hectd3 UTSW 4 116995689 missense possibly damaging 0.67
R3721:Hectd3 UTSW 4 116999745 missense probably benign 0.08
R3895:Hectd3 UTSW 4 116996089 missense probably damaging 1.00
R3937:Hectd3 UTSW 4 116998530 missense probably benign 0.28
R4291:Hectd3 UTSW 4 116995692 missense probably damaging 1.00
R4729:Hectd3 UTSW 4 116997218 missense probably damaging 0.98
R4837:Hectd3 UTSW 4 117002597 missense probably null 0.32
R5059:Hectd3 UTSW 4 116997164 missense possibly damaging 0.93
R5090:Hectd3 UTSW 4 117000238 splice site probably benign
R5910:Hectd3 UTSW 4 117002134 missense probably benign 0.09
R5932:Hectd3 UTSW 4 117002273 missense possibly damaging 0.79
R6182:Hectd3 UTSW 4 117000279 missense probably damaging 1.00
R6292:Hectd3 UTSW 4 116998808 missense probably damaging 1.00
R6405:Hectd3 UTSW 4 117000624 missense probably benign 0.04
R7444:Hectd3 UTSW 4 116996927 missense possibly damaging 0.48
R7471:Hectd3 UTSW 4 116996588 missense probably benign 0.01
R8053:Hectd3 UTSW 4 117000858 missense possibly damaging 0.65
R8671:Hectd3 UTSW 4 116996581 missense possibly damaging 0.67
R8840:Hectd3 UTSW 4 116998407 missense probably benign 0.14
Z1177:Hectd3 UTSW 4 116998760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGGAAGTCTCAGAAAGC -3'
(R):5'- ACCTGGGTGAAGACTGCATTC -3'

Sequencing Primer
(F):5'- TGGAAGTCTCAGAAAGCTTGTG -3'
(R):5'- ATTCTTGCAGGCAGGGTCC -3'
Posted On 2018-05-21