Incidental Mutation 'R7473:Tas2r115'
ID579264
Institutional Source Beutler Lab
Gene Symbol Tas2r115
Ensembl Gene ENSMUSG00000071149
Gene Nametaste receptor, type 2, member 115
SynonymsmGR15, T2R15, Tas2r15, mt2r49
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7473 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location132737003-132738035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132737251 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 246 (S246P)
Ref Sequence ENSEMBL: ENSMUSP00000093043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095394]
Predicted Effect probably damaging
Transcript: ENSMUST00000095394
AA Change: S246P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093043
Gene: ENSMUSG00000071149
AA Change: S246P

DomainStartEndE-ValueType
Pfam:TAS2R 1 299 2.2e-84 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,267,115 S368P possibly damaging Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933434E20Rik T C 3: 90,058,653 probably null Het
A630095N17Rik G A 1: 75,232,031 T15I unknown Het
Actr1b A G 1: 36,709,819 V12A probably benign Het
Add1 A G 5: 34,619,353 T473A possibly damaging Het
Akap11 A T 14: 78,513,888 V353E Het
Alcam G A 16: 52,452,519 probably benign Het
Alpi A G 1: 87,099,647 probably null Het
Ap3s2 A G 7: 79,916,031 F49S probably damaging Het
Arpc1a A G 5: 145,101,076 K174E probably benign Het
Bbox1 A T 2: 110,265,498 S374T probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bmp2k A G 5: 97,057,012 N402S probably benign Het
Bmper C A 9: 23,375,630 A284D probably benign Het
Bpifb2 A T 2: 153,881,196 H124L possibly damaging Het
Bsn C T 9: 108,112,250 R2101Q probably damaging Het
Cacng1 T A 11: 107,716,192 D67V probably damaging Het
Catsperg1 A G 7: 29,195,478 S565P probably damaging Het
Cep126 C T 9: 8,101,778 E252K probably damaging Het
Cep55 G A 19: 38,069,936 E326K probably damaging Het
Cfap58 T A 19: 47,974,625 Y491* probably null Het
Cpeb2 T C 5: 43,277,505 S747P Het
Cryz T A 3: 154,606,520 S85T probably benign Het
D2hgdh T C 1: 93,838,078 V367A probably damaging Het
Dgkh T C 14: 78,599,043 N703S probably benign Het
Dnah11 T C 12: 117,903,176 S4077G probably benign Het
Dnah14 A G 1: 181,752,139 H3079R probably damaging Het
Dnah2 T A 11: 69,491,658 T1209S probably damaging Het
Dnmt3b A G 2: 153,684,450 D804G probably damaging Het
Ell2 A G 13: 75,750,035 E143G probably damaging Het
Exoc2 A G 13: 30,822,630 probably null Het
Fahd2a A T 2: 127,440,456 I131N probably damaging Het
Fer1l5 A G 1: 36,421,608 N1976D possibly damaging Het
Flt1 A G 5: 147,594,595 S853P probably damaging Het
Frg2f1 C T 4: 119,530,793 V170I probably benign Het
Gcn1l1 G A 5: 115,581,804 V373M probably benign Het
Gm10696 T A 3: 94,176,202 K101* probably null Het
Gm19965 A G 1: 116,821,872 T428A unknown Het
Gm4792 A G 10: 94,293,868 I124T unknown Het
Grik2 A T 10: 49,113,522 C804S probably benign Het
Heatr6 T A 11: 83,781,391 I1075N probably damaging Het
Hunk G A 16: 90,453,700 A211T probably damaging Het
Ighe T C 12: 113,271,356 I395V probably damaging Het
Ino80e A T 7: 126,857,312 S104T probably damaging Het
Inpp4a A G 1: 37,369,453 Y305C probably benign Het
Itgae T G 11: 73,140,678 D1073E possibly damaging Het
Lrguk A T 6: 34,029,695 K80M probably benign Het
Map2 A T 1: 66,415,458 D1169V probably damaging Het
Mpst G T 15: 78,413,526 C248F probably damaging Het
Myo9a C A 9: 59,895,244 Q2005K probably benign Het
Nfatc4 C T 14: 55,831,964 T649I probably benign Het
Nmt1 A G 11: 103,046,400 R88G probably benign Het
Nqo1 G A 8: 107,403,097 probably benign Het
Nudt2 T G 4: 41,477,576 M19R probably benign Het
Olfr102 T A 17: 37,313,631 Y251F probably benign Het
Olfr1497 C T 19: 13,795,162 V150M probably benign Het
Olfr517 T A 7: 108,868,269 K295M probably damaging Het
P2ry1 T A 3: 61,004,088 I216N probably damaging Het
Pcx T A 19: 4,619,561 L823* probably null Het
Pkhd1 A G 1: 20,549,756 V880A probably damaging Het
Plcb1 A T 2: 135,344,276 N721I probably damaging Het
Prdm15 T C 16: 97,821,846 K269E possibly damaging Het
Prl7b1 A G 13: 27,602,013 V224A possibly damaging Het
Reln A G 5: 21,929,127 V2601A probably benign Het
Rspo4 G A 2: 151,873,073 R210Q unknown Het
Slc7a5 A T 8: 121,888,423 D228E probably benign Het
Tenm4 A G 7: 96,774,146 Y716C probably damaging Het
Tgfb3 T C 12: 86,062,149 K269E possibly damaging Het
Thoc6 A G 17: 23,670,867 I27T probably benign Het
Tigd5 G A 15: 75,909,899 G37S probably benign Het
Tmem259 C T 10: 79,979,672 D102N possibly damaging Het
Tpo T G 12: 30,092,590 I712L probably benign Het
Ttn G A 2: 76,870,548 T21M possibly damaging Het
Xrcc5 A G 1: 72,312,589 D106G probably damaging Het
Xrn1 T A 9: 95,979,141 F451L probably benign Het
Zar1l T A 5: 150,517,738 D141V probably damaging Het
Zfp27 A T 7: 29,895,899 C214S possibly damaging Het
Znfx1 A T 2: 167,038,824 C1211S probably damaging Het
Other mutations in Tas2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Tas2r115 APN 6 132737778 missense probably benign 0.11
IGL01285:Tas2r115 APN 6 132737678 missense probably damaging 1.00
IGL01516:Tas2r115 APN 6 132737613 missense probably damaging 0.98
IGL01637:Tas2r115 APN 6 132737629 missense probably damaging 0.99
IGL02041:Tas2r115 APN 6 132737467 missense probably benign 0.13
IGL02178:Tas2r115 APN 6 132737308 missense probably benign 0.11
R0467:Tas2r115 UTSW 6 132737719 missense probably benign 0.02
R0553:Tas2r115 UTSW 6 132737959 missense probably benign 0.18
R1425:Tas2r115 UTSW 6 132737479 missense probably benign 0.02
R1770:Tas2r115 UTSW 6 132737971 missense probably damaging 1.00
R2120:Tas2r115 UTSW 6 132737507 missense possibly damaging 0.51
R2136:Tas2r115 UTSW 6 132737346 missense probably damaging 0.99
R2141:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R2142:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R4479:Tas2r115 UTSW 6 132737532 missense probably damaging 0.98
R4687:Tas2r115 UTSW 6 132737284 missense possibly damaging 0.80
R4948:Tas2r115 UTSW 6 132737161 missense probably damaging 1.00
R5097:Tas2r115 UTSW 6 132737253 missense probably damaging 1.00
R5856:Tas2r115 UTSW 6 132737538 missense possibly damaging 0.86
R6927:Tas2r115 UTSW 6 132737932 missense probably damaging 1.00
R7688:Tas2r115 UTSW 6 132737680 missense probably damaging 1.00
Z1088:Tas2r115 UTSW 6 132737081 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTCTAGAATATTCAAGGTGATGC -3'
(R):5'- ACCCTTTGGTGTATCCTTGATAGC -3'

Sequencing Primer
(F):5'- ATGAATCCAAGGTTTTCTCACGC -3'
(R):5'- TGGTGTATCCTTGATAGCTTTCC -3'
Posted On2019-10-07