Incidental Mutation 'R7481:Olfr1480'
ID579841
Institutional Source Beutler Lab
Gene Symbol Olfr1480
Ensembl Gene ENSMUSG00000095484
Gene Nameolfactory receptor 1480
SynonymsMOR202-44, GA_x6K02T2RE5P-3862389-3863336
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7481 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13527913-13531275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13530453 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 304 (Q304L)
Ref Sequence ENSEMBL: ENSMUSP00000146931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072219] [ENSMUST00000207093] [ENSMUST00000207904] [ENSMUST00000207987]
Predicted Effect probably damaging
Transcript: ENSMUST00000072219
AA Change: Q260L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072076
Gene: ENSMUSG00000095484
AA Change: Q260L

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 8.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.6e-6 PFAM
Pfam:7tm_1 40 289 4.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207093
AA Change: Q260L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000207904
AA Change: Q260L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000207987
AA Change: Q304L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,231 F68S unknown Het
Abcb6 A G 1: 75,173,604 F637L probably damaging Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Arhgap45 A T 10: 80,022,300 H387L possibly damaging Het
Arntl2 G A 6: 146,818,871 A178T not run Het
Avil C T 10: 127,007,591 T130I probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C3 C A 17: 57,220,136 W771L probably damaging Het
C6 A G 15: 4,814,875 I926M Het
Cacna1b G A 2: 24,616,862 L1903F probably damaging Het
Car3 A T 3: 14,863,572 M1L probably benign Het
Ccdc175 A G 12: 72,155,624 I299T probably benign Het
Chd9 C T 8: 90,956,438 T502I unknown Het
Clec4a1 G A 6: 122,928,039 C99Y probably damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dmbt1 A T 7: 131,079,511 probably null Het
Dopey1 A T 9: 86,535,932 K1951N probably damaging Het
Dpf3 A C 12: 83,331,927 L122R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Edem3 A T 1: 151,808,222 S687C probably damaging Het
Edem3 G A 1: 151,808,223 S687N possibly damaging Het
Fig4 A G 10: 41,230,005 probably null Het
Fmnl2 A G 2: 53,108,431 T603A unknown Het
Frmd6 T A 12: 70,887,055 L249Q probably damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm6133 A T 18: 78,349,793 M1L probably benign Het
Gm9195 G A 14: 72,482,676 T105I probably benign Het
Hk2 G A 6: 82,760,169 T54I probably benign Het
Jade1 G A 3: 41,604,690 G402D probably benign Het
Kmt2a T C 9: 44,809,071 D3873G unknown Het
Map6 A T 7: 99,269,138 T373S possibly damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mtus1 T A 8: 41,084,615 K21N probably damaging Het
Muc5b C T 7: 141,861,171 T2618I unknown Het
Nbas A G 12: 13,356,959 I852M probably damaging Het
Olfr1167 A G 2: 88,149,761 I86T probably benign Het
Olfr1242 C T 2: 89,494,292 V7I probably benign Het
Olfr125 T A 17: 37,835,398 M133K probably damaging Het
Pank4 A G 4: 154,970,038 N156S probably damaging Het
Pcdhga8 A G 18: 37,727,937 E682G probably benign Het
Pde10a C A 17: 8,949,430 D312E possibly damaging Het
Pkhd1l1 A G 15: 44,512,911 T990A probably benign Het
Rab11fip1 T C 8: 27,156,581 T156A probably damaging Het
Rhbdd2 T A 5: 135,636,177 S121T possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ryr3 C A 2: 112,678,093 R3418S probably benign Het
Ryr3 C A 2: 112,678,094 R3418M possibly damaging Het
Sbno2 G A 10: 80,057,499 P1323S probably benign Het
Sec24d T C 3: 123,350,763 C630R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Skp2 A T 15: 9,113,817 V371E probably damaging Het
Soga3 G T 10: 29,196,523 V604L probably damaging Het
Strbp A T 2: 37,600,754 S496R probably benign Het
Stxbp4 G A 11: 90,594,813 T236I possibly damaging Het
Terf2 C T 8: 107,072,721 probably null Het
Thnsl1 A T 2: 21,211,788 T118S probably benign Het
Tlnrd1 A T 7: 83,882,338 V295E probably damaging Het
Ttll6 A G 11: 96,154,846 T630A probably benign Het
Usp9y G T Y: 1,432,180 A435E probably benign Het
Vil1 A C 1: 74,419,899 R187S probably damaging Het
Vmn2r31 A T 7: 7,384,580 V664E possibly damaging Het
Wdr17 T C 8: 54,661,336 I693M probably benign Het
Wdr82 C T 9: 106,176,666 T72I probably damaging Het
Zbtb5 A G 4: 44,994,905 S160P probably benign Het
Zfat G A 15: 68,178,866 Q769* probably null Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Zglp1 C T 9: 21,062,607 S261N probably benign Het
Other mutations in Olfr1480
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr1480 APN 19 13529850 missense probably damaging 1.00
IGL01446:Olfr1480 APN 19 13530252 missense probably benign 0.00
IGL02300:Olfr1480 APN 19 13529880 missense probably damaging 1.00
IGL02689:Olfr1480 APN 19 13529807 missense probably benign 0.34
IGL03119:Olfr1480 APN 19 13530435 missense probably benign 0.11
R0636:Olfr1480 UTSW 19 13530249 missense possibly damaging 0.89
R1665:Olfr1480 UTSW 19 13529838 missense probably damaging 1.00
R1708:Olfr1480 UTSW 19 13529913 missense probably damaging 1.00
R2100:Olfr1480 UTSW 19 13530434 missense probably benign 0.02
R2137:Olfr1480 UTSW 19 13530438 missense probably damaging 0.98
R3879:Olfr1480 UTSW 19 13530249 missense probably damaging 1.00
R3949:Olfr1480 UTSW 19 13530020 missense probably damaging 0.99
R4780:Olfr1480 UTSW 19 13529955 missense probably benign 0.30
R4953:Olfr1480 UTSW 19 13529814 missense probably null 1.00
R5075:Olfr1480 UTSW 19 13530273 missense probably benign 0.17
R5133:Olfr1480 UTSW 19 13530078 missense probably damaging 1.00
R5656:Olfr1480 UTSW 19 13530380 missense probably benign
R6853:Olfr1480 UTSW 19 13529931 missense possibly damaging 0.48
R6890:Olfr1480 UTSW 19 13530081 missense probably damaging 1.00
R7663:Olfr1480 UTSW 19 13530445 missense probably damaging 0.96
Z1088:Olfr1480 UTSW 19 13529852 missense possibly damaging 0.64
Z1177:Olfr1480 UTSW 19 13530215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTGGCAGCATTCAATGTTG -3'
(R):5'- GCAGTATTGGGTATTCTACTATCTAGG -3'

Sequencing Primer
(F):5'- CAGCATTCAATGTTGCTTTTACTC -3'
(R):5'- TGTCTGAATCCAAAAGGAATACACAG -3'
Posted On2019-10-07