Mutagenetix > Incidental Mutations

Incidental Mutation 'R7481:Cacna1b'

579780

Institutional Source

Beutler Lab

Gene Symbol

Cacna1b

Ensembl Gene

ENSMUSG00000004113

Gene Name

calcium channel, voltage-dependent, N type, alpha 1B subunit

Synonyms

alpha(1B), Cav2.2, Cchn1a

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7481 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24603887-24763152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24616862 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1903 (L1903F)

Ref Sequence

ENSEMBL: ENSMUSP00000037416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447] [ENSMUST00000133892]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041342
AA Change: L1903F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: L1903F

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.2e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.1e-47	PFAM
Pfam:PKD_channel	569	715	2.3e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1408	2.7e-52	PFAM
Pfam:Ion_trans	1498	1698	1.2e-59	PFAM
Pfam:PKD_channel	1551	1705	8.1e-9	PFAM
Ca_chan_IQ	1837	1871	1.09e-11	SMART
low complexity region	2040	2050	N/A	INTRINSIC
low complexity region	2092	2114	N/A	INTRINSIC
low complexity region	2276	2292	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070864
AA Change: L1864F

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: L1864F

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.5e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	848	857	N/A	INTRINSIC
low complexity region	902	912	N/A	INTRINSIC
low complexity region	915	932	N/A	INTRINSIC
low complexity region	1090	1101	N/A	INTRINSIC
Pfam:Ion_trans	1173	1403	1.8e-52	PFAM
Pfam:Ion_trans	1493	1695	5.4e-60	PFAM
Pfam:PKD_channel	1544	1702	4.9e-9	PFAM
Ca_chan_IQ	1798	1832	7.2e-12	SMART
low complexity region	2001	2011	N/A	INTRINSIC
low complexity region	2053	2075	N/A	INTRINSIC
low complexity region	2237	2253	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100348
AA Change: L1904F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: L1904F

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	468	5e-68	PDB
Pfam:Ion_trans	517	709	1.2e-47	PFAM
Pfam:PKD_channel	570	716	1.6e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1175	1409	3.2e-52	PFAM
Pfam:Ion_trans	1499	1699	1.4e-59	PFAM
Pfam:PKD_channel	1552	1706	5.6e-9	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102939
AA Change: L1901F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: L1901F

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	1e-65	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.6e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1404	1.9e-52	PFAM
Pfam:Ion_trans	1494	1696	5.5e-60	PFAM
Pfam:PKD_channel	1545	1703	5e-9	PFAM
Ca_chan_IQ	1835	1869	1.09e-11	SMART
low complexity region	2038	2048	N/A	INTRINSIC
low complexity region	2090	2112	N/A	INTRINSIC
low complexity region	2274	2290	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114447
AA Change: L1904F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: L1904F

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	94	367	8.5e-69	PFAM
Pfam:Ion_trans	482	721	2.4e-57	PFAM
Pfam:PKD_channel	571	715	1e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1139	1421	1.3e-62	PFAM
Pfam:Ion_trans	1464	1711	3.2e-64	PFAM
Pfam:PKD_channel	1550	1706	2.7e-9	PFAM
Pfam:GPHH	1713	1783	1.9e-39	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125798

Predicted Effect

probably damaging
Transcript: ENSMUST00000133892
AA Change: L78F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000115285
Gene: ENSMUSG00000004113
AA Change: L78F

Domain	Start	End	E-Value	Type
Ca_chan_IQ	23	57	1.09e-11	SMART
low complexity region	215	225	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,664,231	F68S	unknown	Het
Abcb6	A	G	1: 75,173,604	F637L	probably damaging	Het
Aldh3b3	A	G	19: 3,964,549	M95V	probably benign	Het
Arhgap45	A	T	10: 80,022,300	H387L	possibly damaging	Het
Arntl2	G	A	6: 146,818,871	A178T	not run	Het
Avil	C	T	10: 127,007,591	T130I	probably benign	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C3	C	A	17: 57,220,136	W771L	probably damaging	Het
C6	A	G	15: 4,814,875	I926M		Het
Car3	A	T	3: 14,863,572	M1L	probably benign	Het
Ccdc175	A	G	12: 72,155,624	I299T	probably benign	Het
Chd9	C	T	8: 90,956,438	T502I	unknown	Het
Clec4a1	G	A	6: 122,928,039	C99Y	probably damaging	Het
Col19a1	C	T	1: 24,317,707	G632R	probably damaging	Het
Dmbt1	A	T	7: 131,079,511		probably null	Het
Dopey1	A	T	9: 86,535,932	K1951N	probably damaging	Het
Dpf3	A	C	12: 83,331,927	L122R	probably damaging	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Edem3	A	T	1: 151,808,222	S687C	probably damaging	Het
Edem3	G	A	1: 151,808,223	S687N	possibly damaging	Het
Fig4	A	G	10: 41,230,005		probably null	Het
Fmnl2	A	G	2: 53,108,431	T603A	unknown	Het
Frmd6	T	A	12: 70,887,055	L249Q	probably damaging	Het
Glrx3	T	C	7: 137,445,022	C48R	probably damaging	Het
Gm40460	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,817		probably benign	Het
Gm6133	A	T	18: 78,349,793	M1L	probably benign	Het
Gm9195	G	A	14: 72,482,676	T105I	probably benign	Het
Hk2	G	A	6: 82,760,169	T54I	probably benign	Het
Jade1	G	A	3: 41,604,690	G402D	probably benign	Het
Kmt2a	T	C	9: 44,809,071	D3873G	unknown	Het
Map6	A	T	7: 99,269,138	T373S	possibly damaging	Het
Megf9	T	C	4: 70,433,442	T481A	probably damaging	Het
Mtus1	T	A	8: 41,084,615	K21N	probably damaging	Het
Muc5b	C	T	7: 141,861,171	T2618I	unknown	Het
Nbas	A	G	12: 13,356,959	I852M	probably damaging	Het
Olfr1167	A	G	2: 88,149,761	I86T	probably benign	Het
Olfr1242	C	T	2: 89,494,292	V7I	probably benign	Het
Olfr125	T	A	17: 37,835,398	M133K	probably damaging	Het
Olfr1480	A	T	19: 13,530,453	Q304L	probably damaging	Het
Pank4	A	G	4: 154,970,038	N156S	probably damaging	Het
Pcdhga8	A	G	18: 37,727,937	E682G	probably benign	Het
Pde10a	C	A	17: 8,949,430	D312E	possibly damaging	Het
Pkhd1l1	A	G	15: 44,512,911	T990A	probably benign	Het
Rab11fip1	T	C	8: 27,156,581	T156A	probably damaging	Het
Rhbdd2	T	A	5: 135,636,177	S121T	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,917		probably benign	Het
Ryr3	C	A	2: 112,678,093	R3418S	probably benign	Het
Ryr3	C	A	2: 112,678,094	R3418M	possibly damaging	Het
Sbno2	G	A	10: 80,057,499	P1323S	probably benign	Het
Sec24d	T	C	3: 123,350,763	C630R	probably damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Skp2	A	T	15: 9,113,817	V371E	probably damaging	Het
Soga3	G	T	10: 29,196,523	V604L	probably damaging	Het
Strbp	A	T	2: 37,600,754	S496R	probably benign	Het
Stxbp4	G	A	11: 90,594,813	T236I	possibly damaging	Het
Terf2	C	T	8: 107,072,721		probably null	Het
Thnsl1	A	T	2: 21,211,788	T118S	probably benign	Het
Tlnrd1	A	T	7: 83,882,338	V295E	probably damaging	Het
Ttll6	A	G	11: 96,154,846	T630A	probably benign	Het
Usp9y	G	T	Y: 1,432,180	A435E	probably benign	Het
Vil1	A	C	1: 74,419,899	R187S	probably damaging	Het
Vmn2r31	A	T	7: 7,384,580	V664E	possibly damaging	Het
Wdr17	T	C	8: 54,661,336	I693M	probably benign	Het
Wdr82	C	T	9: 106,176,666	T72I	probably damaging	Het
Zbtb5	A	G	4: 44,994,905	S160P	probably benign	Het
Zfat	G	A	15: 68,178,866	Q769*	probably null	Het
Zfp937	T	A	2: 150,239,346	I432K	probably benign	Het
Zglp1	C	T	9: 21,062,607	S261N	probably benign	Het

Other mutations in Cacna1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cacna1b	APN	2	24651200	nonsense	probably null
IGL00508:Cacna1b	APN	2	24657289	critical splice donor site	probably null
IGL01085:Cacna1b	APN	2	24678994	missense	probably damaging	0.98
IGL01310:Cacna1b	APN	2	24685782	missense	probably damaging	1.00
IGL01361:Cacna1b	APN	2	24679095	missense	possibly damaging	0.49
IGL01471:Cacna1b	APN	2	24657292	missense	probably damaging	1.00
IGL01537:Cacna1b	APN	2	24658528	missense	probably damaging	1.00
IGL01547:Cacna1b	APN	2	24632035	unclassified	probably benign
IGL01750:Cacna1b	APN	2	24654395	missense	probably damaging	1.00
IGL01813:Cacna1b	APN	2	24609890	missense	probably damaging	1.00
IGL01939:Cacna1b	APN	2	24661757	missense	probably damaging	1.00
IGL01955:Cacna1b	APN	2	24639137	missense	probably damaging	1.00
IGL01972:Cacna1b	APN	2	24635095	critical splice donor site	probably null
IGL01987:Cacna1b	APN	2	24697567	splice site	probably null
IGL02096:Cacna1b	APN	2	24678915	missense	probably benign	0.01
IGL02111:Cacna1b	APN	2	24606991	missense	probably damaging	0.96
IGL02254:Cacna1b	APN	2	24616815	splice site	probably null
IGL03084:Cacna1b	APN	2	24609932	missense	probably benign
IGL03184:Cacna1b	APN	2	24658489	critical splice donor site	probably null
IGL03202:Cacna1b	APN	2	24651112	missense	probably damaging	1.00
IGL03210:Cacna1b	APN	2	24650572	missense	probably benign	0.00
IGL03402:Cacna1b	APN	2	24762809	missense	probably damaging	1.00
PIT4283001:Cacna1b	UTSW	2	24631941	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0206:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0208:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0240:Cacna1b	UTSW	2	24638657	unclassified	probably benign
R0265:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0352:Cacna1b	UTSW	2	24625232	intron	probably benign
R0376:Cacna1b	UTSW	2	24659003	splice site	probably benign
R0383:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0432:Cacna1b	UTSW	2	24687704	missense	probably damaging	1.00
R0595:Cacna1b	UTSW	2	24649989	splice site	probably benign
R0660:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R0664:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R1107:Cacna1b	UTSW	2	24697603	missense	probably damaging	1.00
R1184:Cacna1b	UTSW	2	24687745	unclassified	probably null
R1445:Cacna1b	UTSW	2	24718136	splice site	probably benign
R1446:Cacna1b	UTSW	2	24706177	missense	probably benign	0.01
R1496:Cacna1b	UTSW	2	24678035	missense	probably benign
R1614:Cacna1b	UTSW	2	24690807	missense	possibly damaging	0.88
R1626:Cacna1b	UTSW	2	24606709	missense	probably damaging	1.00
R1917:Cacna1b	UTSW	2	24616879	missense	probably null	0.80
R1984:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1986:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1989:Cacna1b	UTSW	2	24721374	missense	probably damaging	1.00
R1990:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1991:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1992:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R2098:Cacna1b	UTSW	2	24650546	missense	probably damaging	1.00
R2139:Cacna1b	UTSW	2	24679473	missense	probably benign	0.07
R2196:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2229:Cacna1b	UTSW	2	24685804	missense	probably damaging	1.00
R2292:Cacna1b	UTSW	2	24606620	missense	probably benign	0.01
R2570:Cacna1b	UTSW	2	24606637	nonsense	probably null
R2850:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2911:Cacna1b	UTSW	2	24607541	unclassified	probably null
R2937:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R2938:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R3522:Cacna1b	UTSW	2	24763043	missense	possibly damaging	0.94
R3800:Cacna1b	UTSW	2	24658959	missense	probably benign	0.15
R4166:Cacna1b	UTSW	2	24677911	missense	probably benign	0.32
R4300:Cacna1b	UTSW	2	24635239	missense	probably damaging	1.00
R4366:Cacna1b	UTSW	2	24702620	missense	probably damaging	1.00
R4493:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4494:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4522:Cacna1b	UTSW	2	24654430	missense	probably damaging	1.00
R4612:Cacna1b	UTSW	2	24626852	nonsense	probably null
R4673:Cacna1b	UTSW	2	24631944	missense	probably damaging	1.00
R4703:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4704:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4777:Cacna1b	UTSW	2	24732325	missense	probably damaging	1.00
R4795:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4796:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4962:Cacna1b	UTSW	2	24618318	missense	probably damaging	1.00
R4962:Cacna1b	UTSW	2	24657366	missense	probably damaging	1.00
R4974:Cacna1b	UTSW	2	24648523	missense	probably damaging	0.99
R4990:Cacna1b	UTSW	2	24678874	critical splice donor site	probably null
R5109:Cacna1b	UTSW	2	24690785	missense	possibly damaging	0.88
R5117:Cacna1b	UTSW	2	24732328	missense	probably damaging	1.00
R5176:Cacna1b	UTSW	2	24635131	missense	probably damaging	1.00
R5253:Cacna1b	UTSW	2	24719952	missense	probably damaging	1.00
R5372:Cacna1b	UTSW	2	24733959	missense	probably damaging	1.00
R5374:Cacna1b	UTSW	2	24706216	missense	probably damaging	1.00
R5465:Cacna1b	UTSW	2	24650426	critical splice donor site	probably null
R5568:Cacna1b	UTSW	2	24607600	missense	probably damaging	1.00
R5580:Cacna1b	UTSW	2	24650554	missense	probably damaging	1.00
R5677:Cacna1b	UTSW	2	24679358	missense	possibly damaging	0.64
R6277:Cacna1b	UTSW	2	24730796	missense	probably damaging	1.00
R6294:Cacna1b	UTSW	2	24719057	missense	possibly damaging	0.94
R6609:Cacna1b	UTSW	2	24653049	missense	probably damaging	1.00
R6929:Cacna1b	UTSW	2	24632010	missense	probably damaging	1.00
R7016:Cacna1b	UTSW	2	24762848	missense	possibly damaging	0.77
R7112:Cacna1b	UTSW	2	24690761	missense	probably damaging	0.97
R7162:Cacna1b	UTSW	2	24700022	missense	probably benign	0.06
R7401:Cacna1b	UTSW	2	24679294	missense	probably benign	0.00
R7402:Cacna1b	UTSW	2	24607659	missense	probably benign	0.21
R7442:Cacna1b	UTSW	2	24607501	missense	probably benign
R7450:Cacna1b	UTSW	2	24635135	nonsense	probably null
R7792:Cacna1b	UTSW	2	24677965	missense	probably damaging	0.99
Z1088:Cacna1b	UTSW	2	24661844	missense	probably damaging	1.00
Z1088:Cacna1b	UTSW	2	24733945	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGATGTGAGCTAGAGGC -3'
(R):5'- AAACAAGGTTCTATGCGGCAG -3'

Sequencing Primer
(F):5'- TGTGAGCTAGAGGCCAGACTC -3'
(R):5'- TTCTATGCGGCAGAATAAAGAGAC -3'

Posted On

2019-10-07