Incidental Mutation 'R7481:Gm40460'
ID579809
Institutional Source Beutler Lab
Gene Symbol Gm40460
Ensembl Gene ENSMUSG00000110324
Gene Namepredicted gene, 40460
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7481 (G1)
Quality Score158.459
Status Not validated
Chromosome7
Chromosomal Location142240344-142241078 bp(-) (GRCm38)
Type of Mutationsmall deletion (10 aa in frame mutation)
DNA Base Change (assembly) CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG at 142240817 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147331 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000211591
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,231 F68S unknown Het
Abcb6 A G 1: 75,173,604 F637L probably damaging Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Arhgap45 A T 10: 80,022,300 H387L possibly damaging Het
Arntl2 G A 6: 146,818,871 A178T not run Het
Avil C T 10: 127,007,591 T130I probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C3 C A 17: 57,220,136 W771L probably damaging Het
C6 A G 15: 4,814,875 I926M Het
Cacna1b G A 2: 24,616,862 L1903F probably damaging Het
Car3 A T 3: 14,863,572 M1L probably benign Het
Ccdc175 A G 12: 72,155,624 I299T probably benign Het
Chd9 C T 8: 90,956,438 T502I unknown Het
Clec4a1 G A 6: 122,928,039 C99Y probably damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dmbt1 A T 7: 131,079,511 probably null Het
Dopey1 A T 9: 86,535,932 K1951N probably damaging Het
Dpf3 A C 12: 83,331,927 L122R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Edem3 A T 1: 151,808,222 S687C probably damaging Het
Edem3 G A 1: 151,808,223 S687N possibly damaging Het
Fig4 A G 10: 41,230,005 probably null Het
Fmnl2 A G 2: 53,108,431 T603A unknown Het
Frmd6 T A 12: 70,887,055 L249Q probably damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Gm6133 A T 18: 78,349,793 M1L probably benign Het
Gm9195 G A 14: 72,482,676 T105I probably benign Het
Hk2 G A 6: 82,760,169 T54I probably benign Het
Jade1 G A 3: 41,604,690 G402D probably benign Het
Kmt2a T C 9: 44,809,071 D3873G unknown Het
Map6 A T 7: 99,269,138 T373S possibly damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mtus1 T A 8: 41,084,615 K21N probably damaging Het
Muc5b C T 7: 141,861,171 T2618I unknown Het
Nbas A G 12: 13,356,959 I852M probably damaging Het
Olfr1167 A G 2: 88,149,761 I86T probably benign Het
Olfr1242 C T 2: 89,494,292 V7I probably benign Het
Olfr125 T A 17: 37,835,398 M133K probably damaging Het
Olfr1480 A T 19: 13,530,453 Q304L probably damaging Het
Pank4 A G 4: 154,970,038 N156S probably damaging Het
Pcdhga8 A G 18: 37,727,937 E682G probably benign Het
Pde10a C A 17: 8,949,430 D312E possibly damaging Het
Pkhd1l1 A G 15: 44,512,911 T990A probably benign Het
Rab11fip1 T C 8: 27,156,581 T156A probably damaging Het
Rhbdd2 T A 5: 135,636,177 S121T possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ryr3 C A 2: 112,678,093 R3418S probably benign Het
Ryr3 C A 2: 112,678,094 R3418M possibly damaging Het
Sbno2 G A 10: 80,057,499 P1323S probably benign Het
Sec24d T C 3: 123,350,763 C630R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Skp2 A T 15: 9,113,817 V371E probably damaging Het
Soga3 G T 10: 29,196,523 V604L probably damaging Het
Strbp A T 2: 37,600,754 S496R probably benign Het
Stxbp4 G A 11: 90,594,813 T236I possibly damaging Het
Terf2 C T 8: 107,072,721 probably null Het
Thnsl1 A T 2: 21,211,788 T118S probably benign Het
Tlnrd1 A T 7: 83,882,338 V295E probably damaging Het
Ttll6 A G 11: 96,154,846 T630A probably benign Het
Usp9y G T Y: 1,432,180 A435E probably benign Het
Vil1 A C 1: 74,419,899 R187S probably damaging Het
Vmn2r31 A T 7: 7,384,580 V664E possibly damaging Het
Wdr17 T C 8: 54,661,336 I693M probably benign Het
Wdr82 C T 9: 106,176,666 T72I probably damaging Het
Zbtb5 A G 4: 44,994,905 S160P probably benign Het
Zfat G A 15: 68,178,866 Q769* probably null Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Zglp1 C T 9: 21,062,607 S261N probably benign Het
Other mutations in Gm40460
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6822:Gm40460 UTSW 7 142240713 small deletion probably benign
R7016:Gm40460 UTSW 7 142240817 small deletion probably benign
R7053:Gm40460 UTSW 7 142240817 small deletion probably benign
R7083:Gm40460 UTSW 7 142240713 small deletion probably benign
R7087:Gm40460 UTSW 7 142240434 small deletion probably benign
R7110:Gm40460 UTSW 7 142240817 small deletion probably benign
R7184:Gm40460 UTSW 7 142240713 small deletion probably benign
R7224:Gm40460 UTSW 7 142240434 small deletion probably benign
R7367:Gm40460 UTSW 7 142240434 small deletion probably benign
R7411:Gm40460 UTSW 7 142240817 small deletion probably benign
R7491:Gm40460 UTSW 7 142240713 small deletion probably benign
R7553:Gm40460 UTSW 7 142240713 small deletion probably benign
R7637:Gm40460 UTSW 7 142240713 small deletion probably benign
R7643:Gm40460 UTSW 7 142240713 small deletion probably benign
R7663:Gm40460 UTSW 7 142240713 small deletion probably benign
R7785:Gm40460 UTSW 7 142240434 small deletion probably benign
R7871:Gm40460 UTSW 7 142240817 small deletion probably benign
R7895:Gm40460 UTSW 7 142240713 small deletion probably benign
R8054:Gm40460 UTSW 7 142240817 small deletion probably benign
R8355:Gm40460 UTSW 7 142240817 small deletion probably benign
R8389:Gm40460 UTSW 7 142240434 small deletion probably benign
R8501:Gm40460 UTSW 7 142240713 small deletion probably benign
R8509:Gm40460 UTSW 7 142240817 small deletion probably benign
RF040:Gm40460 UTSW 7 142240817 small deletion probably benign
Z1177:Gm40460 UTSW 7 142240772 missense unknown
Z1177:Gm40460 UTSW 7 142240906 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGATTGACAGCAGCAGGGC -3'
(R):5'- AGAACCATGACCTGCTGTGG -3'

Sequencing Primer
(F):5'- GCTTGCAGCAACTGGACTG -3'
(R):5'- CTGCTGCAAGCCTGTGTG -3'
Posted On2019-10-07