Incidental Mutation 'R7596:Samhd1'
ID587708
Institutional Source Beutler Lab
Gene Symbol Samhd1
Ensembl Gene ENSMUSG00000027639
Gene NameSAM domain and HD domain, 1
SynonymsE330031J07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7596 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location157097533-157135265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 157101834 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 587 (F587I)
Ref Sequence ENSEMBL: ENSMUSP00000059717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057725] [ENSMUST00000088523] [ENSMUST00000109549] [ENSMUST00000123932]
Predicted Effect probably damaging
Transcript: ENSMUST00000057725
AA Change: F587I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059717
Gene: ENSMUSG00000027639
AA Change: F587I

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088523
AA Change: F587I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085880
Gene: ENSMUSG00000027639
AA Change: F587I

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 2e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109549
SMART Domains Protein: ENSMUSP00000105176
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123932
SMART Domains Protein: ENSMUSP00000124599
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SAM 43 112 1.51e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124935
Gene: ENSMUSG00000027639
AA Change: F566I

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
SAM 54 122 4.4e-14 SMART
HDc 172 337 1.89e-9 SMART
Blast:HDc 378 417 2e-16 BLAST
low complexity region 486 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in regulation of the innate immune response. The encoded protein is upregulated in response to viral infection and may be involved in mediation of tumor necrosis factor-alpha proinflammatory responses. Mutations in this gene have been associated with Aicardi-Goutieres syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to infection with pseudotyped HIV-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G A 16: 88,759,336 S146N probably damaging Het
Adam26b A C 8: 43,520,200 D588E probably benign Het
Ankrd13b C A 11: 77,472,314 R547L probably benign Het
Bckdk G T 7: 127,906,400 E232* probably null Het
C8a T C 4: 104,853,867 K244E possibly damaging Het
Cad A G 5: 31,069,048 I1145V probably benign Het
Cd28 C A 1: 60,763,328 H135Q possibly damaging Het
Ceacam19 A G 7: 19,881,887 I209T possibly damaging Het
Cecr2 A G 6: 120,762,206 N1298S probably benign Het
Cpne5 C T 17: 29,226,217 D38N possibly damaging Het
Dcn A T 10: 97,510,009 I228F probably damaging Het
Gm10696 T A 3: 94,176,430 T25S probably benign Het
Gm5591 T G 7: 38,520,184 I422L probably benign Het
Gnptab T G 10: 88,443,370 F1201V probably damaging Het
Hc A G 2: 35,000,847 V1319A probably damaging Het
Htr3b T C 9: 48,936,061 N385D probably benign Het
Ikbip A T 10: 91,083,029 probably benign Het
Kcnk1 T C 8: 125,995,611 L51P probably damaging Het
Lcn2 A G 2: 32,385,709 Y160H probably damaging Het
Lig1 T C 7: 13,305,998 S712P probably damaging Het
Lrrc19 T G 4: 94,643,355 M7L probably benign Het
Lrrc4b C T 7: 44,461,886 T394M probably damaging Het
Map7 A G 10: 20,278,181 N681S unknown Het
Mdga2 A T 12: 66,506,123 M912K probably damaging Het
Mlst8 C T 17: 24,478,110 probably null Het
Ms4a13 A T 19: 11,169,965 V195D unknown Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nr4a2 G C 2: 57,108,231 F574L probably damaging Het
Nup107 T C 10: 117,777,160 N288D probably damaging Het
Olfr1469 C T 19: 13,411,147 H193Y probably benign Het
Olfr211 T A 6: 116,494,197 V196D probably benign Het
Olfr742 A T 14: 50,515,545 T114S probably benign Het
Pcolce A G 5: 137,606,825 probably null Het
Pik3cg A G 12: 32,204,741 F416L probably damaging Het
Podnl1 A G 8: 84,126,395 I65V Het
Prpf8 T C 11: 75,491,504 F387S probably benign Het
Rev3l A G 10: 39,821,538 Y677C probably damaging Het
Rhpn1 A G 15: 75,712,313 T430A probably benign Het
Rnf187 T C 11: 58,938,415 R124G possibly damaging Het
Rpl9-ps6 C T 19: 32,466,383 V57I probably benign Het
Slc30a6 A G 17: 74,415,669 T244A probably benign Het
Slc35f4 T A 14: 49,306,209 Y310F probably damaging Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Smc5 A C 19: 23,214,169 V889G probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tango2 A G 16: 18,302,710 V229A probably damaging Het
Tnks1bp1 A G 2: 85,062,713 T995A probably benign Het
Trio A T 15: 27,749,826 I2263N probably damaging Het
Ttc28 T C 5: 111,280,124 F1829L probably damaging Het
Ttn A G 2: 76,808,579 S13920P probably damaging Het
Ube2b T C 11: 51,986,743 N133S probably damaging Het
Ubn1 T A 16: 5,081,558 H1055Q probably benign Het
Ubtf G A 11: 102,306,707 T705M unknown Het
Vmn2r109 A T 17: 20,540,680 M805K probably damaging Het
Vsig10 T C 5: 117,334,783 V147A possibly damaging Het
Zbtb16 C A 9: 48,832,404 V203L possibly damaging Het
Other mutations in Samhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Samhd1 APN 2 157120548 missense probably damaging 1.00
IGL00903:Samhd1 APN 2 157107423 splice site probably benign
IGL01313:Samhd1 APN 2 157116401 missense probably damaging 1.00
IGL01775:Samhd1 APN 2 157114330 splice site probably benign
IGL02245:Samhd1 APN 2 157110555 missense possibly damaging 0.46
IGL02314:Samhd1 APN 2 157135028 missense probably damaging 0.98
R0390:Samhd1 UTSW 2 157114231 missense probably damaging 1.00
R0487:Samhd1 UTSW 2 157110615 missense probably damaging 1.00
R0842:Samhd1 UTSW 2 157123331 missense probably damaging 0.99
R1199:Samhd1 UTSW 2 157109461 missense probably damaging 0.99
R1681:Samhd1 UTSW 2 157101732 missense probably benign 0.45
R1775:Samhd1 UTSW 2 157107547 missense probably benign 0.16
R2859:Samhd1 UTSW 2 157106229 critical splice donor site probably null
R2903:Samhd1 UTSW 2 157123415 missense possibly damaging 0.95
R2905:Samhd1 UTSW 2 157123415 missense possibly damaging 0.95
R3983:Samhd1 UTSW 2 157123449 missense possibly damaging 0.81
R4432:Samhd1 UTSW 2 157104893 missense probably damaging 0.99
R4576:Samhd1 UTSW 2 157101750 missense probably damaging 1.00
R5283:Samhd1 UTSW 2 157109492 missense possibly damaging 0.70
R5741:Samhd1 UTSW 2 157112831 missense probably benign
R6021:Samhd1 UTSW 2 157120554 critical splice acceptor site probably null
R6518:Samhd1 UTSW 2 157114297 missense possibly damaging 0.62
R6818:Samhd1 UTSW 2 157107497 missense probably benign 0.04
R6924:Samhd1 UTSW 2 157109483 missense probably benign 0.00
R7307:Samhd1 UTSW 2 157135020 missense probably benign 0.27
R7337:Samhd1 UTSW 2 157106244 missense probably damaging 0.99
R7892:Samhd1 UTSW 2 157116495 missense probably damaging 1.00
R8081:Samhd1 UTSW 2 157101438 nonsense probably null
R8234:Samhd1 UTSW 2 157116350 critical splice donor site probably null
R8400:Samhd1 UTSW 2 157099433 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTTTCGGGCTTTCCTTAAAGATTG -3'
(R):5'- GCGCAGTGCTTTTAACTCAAC -3'

Sequencing Primer
(F):5'- TACACTCGCATCTTGGGAAG -3'
(R):5'- GTTCTTGGCAGAGTGAAC -3'
Posted On2019-10-24