Incidental Mutation 'R7657:Mbd1'
ID591308
Institutional Source Beutler Lab
Gene Symbol Mbd1
Ensembl Gene ENSMUSG00000024561
Gene Namemethyl-CpG binding domain protein 1
SynonymsPCM1, Cxxc3
Accession Numbers

NCBI RefSeq: NM_013594.2; MGI:1333811

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7657 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location74267605-74282732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74274733 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 277 (L277R)
Ref Sequence ENSEMBL: ENSMUSP00000095137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097530] [ENSMUST00000224047] [ENSMUST00000224332]
Predicted Effect probably damaging
Transcript: ENSMUST00000097530
AA Change: L277R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095137
Gene: ENSMUSG00000024561
AA Change: L277R

DomainStartEndE-ValueType
MBD 3 76 3.94e-27 SMART
low complexity region 82 97 N/A INTRINSIC
low complexity region 123 153 N/A INTRINSIC
Pfam:zf-CXXC 194 241 1.9e-13 PFAM
Pfam:zf-CXXC 243 288 1.2e-13 PFAM
low complexity region 358 368 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224047
AA Change: L277R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224332
AA Change: L167R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 2664084
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null exhibited defects in adult hippocampal neurogenesis and function. Spatial learning was also impaired in mutant mice. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,511 E28G possibly damaging Het
Acot6 G A 12: 84,106,530 G182D possibly damaging Het
Actl9 A G 17: 33,433,040 T25A probably benign Het
Adam26b G A 8: 43,521,542 T141I possibly damaging Het
Agl T C 3: 116,779,163 H148R Het
Angptl1 A G 1: 156,857,220 I320V probably benign Het
Arhgef10 C T 8: 14,979,893 R932C probably damaging Het
Atp13a2 A G 4: 140,992,504 E91G possibly damaging Het
Bptf T A 11: 107,074,729 E1213V probably damaging Het
C530025M09Rik A G 2: 149,830,621 V198A unknown Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Col1a2 A T 6: 4,527,152 K627M probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dctn2 T C 10: 127,266,514 Y6H probably damaging Het
Denr T C 5: 123,908,200 V31A probably damaging Het
Entpd7 T C 19: 43,725,467 F422L possibly damaging Het
Fam208b A G 13: 3,573,777 S2058P probably damaging Het
Fastkd5 G C 2: 130,616,256 P138R probably benign Het
Fmn1 G T 2: 113,525,193 A758S unknown Het
Fmo2 A G 1: 162,888,844 V58A probably damaging Het
Fmo6 A G 1: 162,922,716 I257T probably benign Het
Foxn1 T C 11: 78,365,964 T302A probably benign Het
Ganab C T 19: 8,907,357 L175F probably damaging Het
Gjd3 G T 11: 98,982,760 S86* probably null Het
Gm1330 A G 2: 148,999,234 probably null Het
Gm18596 A C 10: 77,742,113 S176A unknown Het
Gnl2 A G 4: 125,030,158 S10G probably benign Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Grik2 T C 10: 49,783,151 R37G probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Hhla1 T C 15: 65,965,459 T99A probably damaging Het
Igtp A T 11: 58,206,828 Q275L probably benign Het
Itga6 G A 2: 71,846,251 A993T probably benign Het
Jakmip3 T A 7: 139,019,174 I234N probably damaging Het
Kcnh7 A G 2: 62,736,035 F851L probably damaging Het
Krr1 A G 10: 111,975,599 Y66C probably damaging Het
Krt33a T A 11: 100,015,867 Q94L probably benign Het
Mat1a A T 14: 41,122,519 K369* probably null Het
Mmp21 C T 7: 133,678,833 G136D probably benign Het
Mroh3 A G 1: 136,181,794 Y892H possibly damaging Het
Ncbp3 G A 11: 73,073,367 R381Q probably damaging Het
Nlrp2 T A 7: 5,319,168 I827L probably benign Het
Olfr1136 C T 2: 87,692,992 V297I probably damaging Het
Olfr1310 A G 2: 112,008,748 V146A probably benign Het
Olfr316 A T 11: 58,757,929 D88V probably benign Het
Oxt C T 2: 130,576,790 P107L possibly damaging Het
Pcdhga2 G A 18: 37,670,428 V442M probably damaging Het
Phtf1 T G 3: 103,969,113 S10A probably benign Het
Plb1 A C 5: 32,329,867 N902T probably damaging Het
Plppr3 T C 10: 79,866,438 I267V probably benign Het
Pms2 C A 5: 143,919,539 H278Q possibly damaging Het
Pmvk T A 3: 89,468,851 S154T possibly damaging Het
Polr3b T A 10: 84,655,991 M338K probably damaging Het
Ppp1r21 T A 17: 88,555,682 I283N probably damaging Het
Rft1 T A 14: 30,666,767 L216H probably damaging Het
Rtl1 T C 12: 109,595,384 D7G possibly damaging Het
Slc13a2 A G 11: 78,398,397 V496A probably damaging Het
Slc14a1 A G 18: 78,113,664 probably null Het
Slc8a3 T C 12: 81,314,384 R554G probably damaging Het
Spata31d1b T C 13: 59,715,763 S242P possibly damaging Het
Spocd1 G A 4: 129,929,742 V111I Het
Stxbp5l G A 16: 37,210,172 A479V probably null Het
Tmem238 C G 7: 4,789,227 G106R probably damaging Het
Trak1 T G 9: 121,472,586 Y803D probably damaging Het
Trim5 T C 7: 104,276,677 S226G possibly damaging Het
Trim6 T A 7: 104,231,861 D282E possibly damaging Het
Ube2e2 A G 14: 18,586,997 V121A probably benign Het
Ufd1 T G 16: 18,817,963 M77R probably benign Het
Unc13c C T 9: 73,533,903 probably null Het
Wfs1 A G 5: 36,968,234 S438P probably benign Het
Zbtb6 A C 2: 37,429,075 D280E probably benign Het
Zfp595 G A 13: 67,317,753 L152F probably damaging Het
Zfpm2 A G 15: 41,103,275 E1052G possibly damaging Het
Zmym5 A G 14: 56,804,196 V150A probably benign Het
Other mutations in Mbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Mbd1 APN 18 74275239 missense possibly damaging 0.72
IGL01551:Mbd1 APN 18 74269543 unclassified probably benign
IGL02213:Mbd1 APN 18 74275382 missense probably damaging 1.00
IGL02562:Mbd1 APN 18 74276922 missense probably benign 0.00
IGL02596:Mbd1 APN 18 74276797 splice site probably benign
IGL02944:Mbd1 APN 18 74277410 missense probably damaging 1.00
IGL02973:Mbd1 APN 18 74275427 splice site probably benign
IGL03200:Mbd1 APN 18 74276431 missense probably benign 0.02
IGL03247:Mbd1 APN 18 74274754 nonsense probably null
IGL03340:Mbd1 APN 18 74274482 missense probably benign 0.00
FR4737:Mbd1 UTSW 18 74273573 small deletion probably benign
P0016:Mbd1 UTSW 18 74274538 nonsense probably null
R0385:Mbd1 UTSW 18 74273241 frame shift probably null
R0630:Mbd1 UTSW 18 74276727 splice site probably benign
R0717:Mbd1 UTSW 18 74273597 missense possibly damaging 0.89
R1084:Mbd1 UTSW 18 74269532 missense probably damaging 1.00
R1290:Mbd1 UTSW 18 74269486 missense possibly damaging 0.59
R1575:Mbd1 UTSW 18 74275419 critical splice donor site probably null
R2065:Mbd1 UTSW 18 74276884 missense probably damaging 1.00
R2192:Mbd1 UTSW 18 74277378 missense probably damaging 0.99
R2308:Mbd1 UTSW 18 74276477 missense probably benign 0.42
R2697:Mbd1 UTSW 18 74273617 missense possibly damaging 0.95
R3407:Mbd1 UTSW 18 74277367 missense possibly damaging 0.94
R4348:Mbd1 UTSW 18 74274416 missense probably damaging 1.00
R4664:Mbd1 UTSW 18 74269526 missense possibly damaging 0.86
R5460:Mbd1 UTSW 18 74269510 missense probably benign 0.03
R5860:Mbd1 UTSW 18 74276697 nonsense probably null
R6431:Mbd1 UTSW 18 74273691 intron probably null
R6734:Mbd1 UTSW 18 74276043 missense probably damaging 1.00
R6861:Mbd1 UTSW 18 74273574
R7363:Mbd1 UTSW 18 74273286 missense probably damaging 0.97
R7543:Mbd1 UTSW 18 74274449 missense probably damaging 0.97
R7871:Mbd1 UTSW 18 74274057 critical splice donor site probably null
R7954:Mbd1 UTSW 18 74274057 critical splice donor site probably null
RF005:Mbd1 UTSW 18 74273573 small deletion probably benign
RF011:Mbd1 UTSW 18 74273610 small deletion probably benign
RF024:Mbd1 UTSW 18 74273573 small deletion probably benign
RF024:Mbd1 UTSW 18 74273610 small deletion probably benign
RF058:Mbd1 UTSW 18 74273609 frame shift probably null
Z1177:Mbd1 UTSW 18 74276939 missense probably null 0.72
Predicted Primers PCR Primer
(F):5'- AAGGTGAGCCCAGTCACAAG -3'
(R):5'- ACATCCTTGAGAGTGGCCTC -3'

Sequencing Primer
(F):5'- CGGCTGACTCCAGACAT -3'
(R):5'- CTTGAGAGTGGCCTCGGAAG -3'
Posted On2019-11-12