Mutagenetix > Incidental Mutation

Incidental Mutation 'R7657:Zfpm2'

591301

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41103275 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1052 (E1052G)

Ref Sequence

ENSEMBL: ENSMUSP00000051335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053467
AA Change: E1052G

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: E1052G

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230319
AA Change: E920G

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

Meta Mutation Damage Score

0.1067

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,208,511	E28G	possibly damaging	Het
Acot6	G	A	12: 84,106,530	G182D	possibly damaging	Het
Actl9	A	G	17: 33,433,040	T25A	probably benign	Het
Adam26b	G	A	8: 43,521,542	T141I	possibly damaging	Het
Agl	T	C	3: 116,779,163	H148R		Het
Angptl1	A	G	1: 156,857,220	I320V	probably benign	Het
Arhgef10	C	T	8: 14,979,893	R932C	probably damaging	Het
Atp13a2	A	G	4: 140,992,504	E91G	possibly damaging	Het
Bptf	T	A	11: 107,074,729	E1213V	probably damaging	Het
C530025M09Rik	A	G	2: 149,830,621	V198A	unknown	Het
Casd1	A	T	6: 4,619,773	I173F	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Col1a2	A	T	6: 4,527,152	K627M	probably null	Het
Ctcfl	G	A	2: 173,113,656	T271I	possibly damaging	Het
Dctn2	T	C	10: 127,266,514	Y6H	probably damaging	Het
Denr	T	C	5: 123,908,200	V31A	probably damaging	Het
Entpd7	T	C	19: 43,725,467	F422L	possibly damaging	Het
Fam208b	A	G	13: 3,573,777	S2058P	probably damaging	Het
Fastkd5	G	C	2: 130,616,256	P138R	probably benign	Het
Fmn1	G	T	2: 113,525,193	A758S	unknown	Het
Fmo2	A	G	1: 162,888,844	V58A	probably damaging	Het
Fmo6	A	G	1: 162,922,716	I257T	probably benign	Het
Foxn1	T	C	11: 78,365,964	T302A	probably benign	Het
Ganab	C	T	19: 8,907,357	L175F	probably damaging	Het
Gga1	A	T	15: 78,889,127		probably null	Het
Gjd3	G	T	11: 98,982,760	S86*	probably null	Het
Gm1330	A	G	2: 148,999,234		probably null	Het
Gm18596	A	C	10: 77,742,113	S176A	unknown	Het
Gnl2	A	G	4: 125,030,158	S10G	probably benign	Het
Gpsm2	G	A	3: 108,700,745	A239V	probably damaging	Het
Grik2	T	C	10: 49,783,151	R37G	probably benign	Het
Grm3	A	G	5: 9,511,452		probably null	Het
Gtpbp3	T	C	8: 71,491,121	L216P	probably benign	Het
Hhla1	T	C	15: 65,965,459	T99A	probably damaging	Het
Igtp	A	T	11: 58,206,828	Q275L	probably benign	Het
Itga6	G	A	2: 71,846,251	A993T	probably benign	Het
Jakmip3	T	A	7: 139,019,174	I234N	probably damaging	Het
Kcnh7	A	G	2: 62,736,035	F851L	probably damaging	Het
Krr1	A	G	10: 111,975,599	Y66C	probably damaging	Het
Krt33a	T	A	11: 100,015,867	Q94L	probably benign	Het
Mat1a	A	T	14: 41,122,519	K369*	probably null	Het
Mbd1	T	G	18: 74,274,733	L277R	probably damaging	Het
Mmp21	C	T	7: 133,678,833	G136D	probably benign	Het
Mroh3	A	G	1: 136,181,794	Y892H	possibly damaging	Het
Ncbp3	G	A	11: 73,073,367	R381Q	probably damaging	Het
Nlrp2	T	A	7: 5,319,168	I827L	probably benign	Het
Nrip1	T	A	16: 76,294,699		probably null	Het
Olfr1136	C	T	2: 87,692,992	V297I	probably damaging	Het
Olfr1310	A	G	2: 112,008,748	V146A	probably benign	Het
Olfr316	A	T	11: 58,757,929	D88V	probably benign	Het
Oxt	C	T	2: 130,576,790	P107L	possibly damaging	Het
Pcdhga2	G	A	18: 37,670,428	V442M	probably damaging	Het
Phtf1	T	G	3: 103,969,113	S10A	probably benign	Het
Plb1	A	C	5: 32,329,867	N902T	probably damaging	Het
Plppr3	T	C	10: 79,866,438	I267V	probably benign	Het
Pms2	C	A	5: 143,919,539	H278Q	possibly damaging	Het
Pmvk	T	A	3: 89,468,851	S154T	possibly damaging	Het
Polr3b	T	A	10: 84,655,991	M338K	probably damaging	Het
Ppp1r21	T	A	17: 88,555,682	I283N	probably damaging	Het
Ptprj	A	T	2: 90,452,157		probably null	Het
Rft1	T	A	14: 30,666,767	L216H	probably damaging	Het
Rpl3	G	A	15: 80,081,057	P174S	probably benign	Het
Rtl1	T	C	12: 109,595,384	D7G	possibly damaging	Het
Slc13a2	A	G	11: 78,398,397	V496A	probably damaging	Het
Slc14a1	A	G	18: 78,113,664		probably null	Het
Slc8a3	T	C	12: 81,314,384	R554G	probably damaging	Het
Spata31d1b	T	C	13: 59,715,763	S242P	possibly damaging	Het
Spocd1	G	A	4: 129,929,742	V111I		Het
Stxbp5l	G	A	16: 37,210,172	A479V	probably null	Het
Tmem238	C	G	7: 4,789,227	G106R	probably damaging	Het
Trak1	T	G	9: 121,472,586	Y803D	probably damaging	Het
Trim5	T	C	7: 104,276,677	S226G	possibly damaging	Het
Trim6	T	A	7: 104,231,861	D282E	possibly damaging	Het
Ube2e2	A	G	14: 18,586,997	V121A	probably benign	Het
Ufd1	T	G	16: 18,817,963	M77R	probably benign	Het
Unc13c	C	T	9: 73,533,903		probably null	Het
Wfs1	A	G	5: 36,968,234	S438P	probably benign	Het
Zbtb6	A	C	2: 37,429,075	D280E	probably benign	Het
Zfp595	G	A	13: 67,317,753	L152F	probably damaging	Het
Zmym5	A	G	14: 56,804,196	V150A	probably benign	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGGGATAAAGCCAAGCGATTATATC -3'
(R):5'- ATTTTCCACTGCTGGGAGCC -3'

Sequencing Primer
(F):5'- CGATTATATCGCCAGTTCTCTTG -3'
(R):5'- GCTGGCGCCATTCACAC -3'

Posted On

2019-11-12