Incidental Mutation 'R7817:Serpina3b'
ID 601605
Institutional Source Beutler Lab
Gene Symbol Serpina3b
Ensembl Gene ENSMUSG00000066364
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonyms antitrypsin, A030003A19Rik, alpha-1 antiproteinase, 6A1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7817 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 104127996-104139545 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104132964 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 246 (N246S)
Ref Sequence ENSEMBL: ENSMUSP00000082127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085052]
AlphaFold Q8BYY9
Predicted Effect probably benign
Transcript: ENSMUST00000085052
AA Change: N246S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000082127
Gene: ENSMUSG00000066364
AA Change: N246S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 56 417 1.1e-153 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 T C 7: 66,909,476 V338A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bivm G T 1: 44,126,401 A4S probably benign Het
Cacng3 G A 7: 122,768,599 R234Q probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cftr A G 6: 18,267,968 D642G probably damaging Het
Cltc A G 11: 86,725,123 V443A probably damaging Het
Csmd3 C T 15: 47,857,960 R1425H probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Dscam T C 16: 96,640,864 T1588A probably benign Het
Gabra4 A G 5: 71,640,863 M207T probably damaging Het
Galnt3 A G 2: 66,095,899 Y322H probably damaging Het
Glud1 A T 14: 34,329,287 probably null Het
Gm47189 A G 14: 41,770,054 Y89H probably damaging Het
Klhl1 A T 14: 96,136,750 M620K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mocs2 A G 13: 114,820,846 E62G probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Nek10 C T 14: 15,001,017 P1066S probably benign Het
Nfxl1 T C 5: 72,514,289 K876E possibly damaging Het
Nipsnap3a T A 4: 52,997,279 F182I probably damaging Het
Nlrc3 C T 16: 3,965,463 G60S possibly damaging Het
Notch2 T C 3: 98,107,127 Y666H probably damaging Het
Olfr1160 T C 2: 88,006,011 I247V probably benign Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdhb11 A G 18: 37,423,909 E764G probably damaging Het
Pcdhb3 T A 18: 37,302,929 D649E probably benign Het
Pde7b T G 10: 20,443,305 R90S probably damaging Het
Pik3r5 T C 11: 68,493,657 V625A probably damaging Het
Prdm9 G A 17: 15,559,049 R113W probably damaging Het
Psg26 A G 7: 18,482,647 V89A not run Het
Rad1 T C 15: 10,493,318 V277A probably benign Het
Rb1 A T 14: 73,198,543 L894Q probably damaging Het
Rorb A T 19: 18,988,096 C10S probably damaging Het
Ryk C T 9: 102,891,233 Q361* probably null Het
Srr A G 11: 74,908,698 V317A possibly damaging Het
Timd2 A T 11: 46,670,954 C288S probably benign Het
Tomm70a C T 16: 57,144,773 A440V probably damaging Het
Trim62 T C 4: 128,900,685 V215A probably benign Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Unc13d A T 11: 116,076,283 V91D probably damaging Het
Vmn1r159 T A 7: 22,843,062 I182F possibly damaging Het
Vmn1r230 T A 17: 20,846,561 V4D probably benign Het
Zfp27 T C 7: 29,896,390 Y50C possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp518b T C 5: 38,672,398 I755V not run Het
Other mutations in Serpina3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Serpina3b APN 12 104138787 missense probably benign 0.03
IGL00427:Serpina3b APN 12 104132941 missense probably benign 0.06
IGL01637:Serpina3b APN 12 104132957 missense probably benign 0.00
IGL01738:Serpina3b APN 12 104130832 missense probably damaging 1.00
IGL02403:Serpina3b APN 12 104130462 start codon destroyed probably null 1.00
IGL03118:Serpina3b APN 12 104131054 missense probably benign 0.22
R0141:Serpina3b UTSW 12 104130771 missense probably damaging 1.00
R0217:Serpina3b UTSW 12 104130727 missense probably damaging 1.00
R0437:Serpina3b UTSW 12 104130670 missense probably damaging 1.00
R1295:Serpina3b UTSW 12 104130879 missense probably damaging 1.00
R1463:Serpina3b UTSW 12 104138710 missense probably benign 0.02
R1802:Serpina3b UTSW 12 104138637 missense probably damaging 1.00
R2104:Serpina3b UTSW 12 104138810 missense probably benign 0.01
R3871:Serpina3b UTSW 12 104138788 missense probably damaging 1.00
R4720:Serpina3b UTSW 12 104130630 missense possibly damaging 0.80
R5827:Serpina3b UTSW 12 104130777 missense probably benign 0.02
R5970:Serpina3b UTSW 12 104134091 missense possibly damaging 0.82
R6014:Serpina3b UTSW 12 104131097 missense possibly damaging 0.93
R6102:Serpina3b UTSW 12 104134169 missense probably benign 0.00
R6673:Serpina3b UTSW 12 104130669 missense probably damaging 0.96
R6807:Serpina3b UTSW 12 104132992 missense probably benign 0.00
R6836:Serpina3b UTSW 12 104134082 missense probably benign 0.30
R6893:Serpina3b UTSW 12 104133026 missense probably benign 0.04
R7414:Serpina3b UTSW 12 104132886 missense probably benign 0.03
R7539:Serpina3b UTSW 12 104130711 missense possibly damaging 0.75
R7748:Serpina3b UTSW 12 104130463 start codon destroyed probably null 1.00
R8040:Serpina3b UTSW 12 104131076 missense probably benign 0.00
R8143:Serpina3b UTSW 12 104130534 missense probably benign 0.06
R8360:Serpina3b UTSW 12 104138703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCATATGCCACTCTGAGG -3'
(R):5'- GGGCCTCAAAGATTTCCTCC -3'

Sequencing Primer
(F):5'- ATATGCCACTCTGAGGGACACTG -3'
(R):5'- AAAGATTTCCTCCACTTCTTCAGGG -3'
Posted On 2019-12-03