Incidental Mutation 'R7817:Olfr1160'
ID601579
Institutional Source Beutler Lab
Gene Symbol Olfr1160
Ensembl Gene ENSMUSG00000075141
Gene Nameolfactory receptor 1160
SynonymsMOR173-1, GA_x6K02T2Q125-49498697-49497765
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7817 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88000927-88008268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88006011 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 247 (I247V)
Ref Sequence ENSEMBL: ENSMUSP00000148857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099839] [ENSMUST00000215457]
Predicted Effect probably benign
Transcript: ENSMUST00000099839
AA Change: I256V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097427
Gene: ENSMUSG00000075141
AA Change: I256V

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 1.2e-46 PFAM
Pfam:7tm_1 50 298 2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215457
AA Change: I247V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 T C 7: 66,909,476 V338A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bivm G T 1: 44,126,401 A4S probably benign Het
Cacng3 G A 7: 122,768,599 R234Q probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cftr A G 6: 18,267,968 D642G probably damaging Het
Cltc A G 11: 86,725,123 V443A probably damaging Het
Csmd3 C T 15: 47,857,960 R1425H probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Dscam T C 16: 96,640,864 T1588A probably benign Het
Gabra4 A G 5: 71,640,863 M207T probably damaging Het
Galnt3 A G 2: 66,095,899 Y322H probably damaging Het
Glud1 A T 14: 34,329,287 probably null Het
Gm47189 A G 14: 41,770,054 Y89H probably damaging Het
Klhl1 A T 14: 96,136,750 M620K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mocs2 A G 13: 114,820,846 E62G probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Nek10 C T 14: 15,001,017 P1066S probably benign Het
Nfxl1 T C 5: 72,514,289 K876E possibly damaging Het
Nipsnap3a T A 4: 52,997,279 F182I probably damaging Het
Nlrc3 C T 16: 3,965,463 G60S possibly damaging Het
Notch2 T C 3: 98,107,127 Y666H probably damaging Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdhb11 A G 18: 37,423,909 E764G probably damaging Het
Pcdhb3 T A 18: 37,302,929 D649E probably benign Het
Pde7b T G 10: 20,443,305 R90S probably damaging Het
Pik3r5 T C 11: 68,493,657 V625A probably damaging Het
Prdm9 G A 17: 15,559,049 R113W probably damaging Het
Psg26 A G 7: 18,482,647 V89A not run Het
Rad1 T C 15: 10,493,318 V277A probably benign Het
Rb1 A T 14: 73,198,543 L894Q probably damaging Het
Rorb A T 19: 18,988,096 C10S probably damaging Het
Ryk C T 9: 102,891,233 Q361* probably null Het
Serpina3b A G 12: 104,132,964 N246S probably benign Het
Srr A G 11: 74,908,698 V317A possibly damaging Het
Timd2 A T 11: 46,670,954 C288S probably benign Het
Tomm70a C T 16: 57,144,773 A440V probably damaging Het
Trim62 T C 4: 128,900,685 V215A probably benign Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Unc13d A T 11: 116,076,283 V91D probably damaging Het
Vmn1r159 T A 7: 22,843,062 I182F possibly damaging Het
Vmn1r230 T A 17: 20,846,561 V4D probably benign Het
Zfp27 T C 7: 29,896,390 Y50C possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp518b T C 5: 38,672,398 I755V not run Het
Other mutations in Olfr1160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Olfr1160 APN 2 88006644 missense probably damaging 1.00
IGL01321:Olfr1160 APN 2 88006245 missense probably damaging 0.97
IGL02009:Olfr1160 APN 2 88006773 missense probably benign
IGL03409:Olfr1160 APN 2 88005895 missense probably damaging 1.00
R0089:Olfr1160 UTSW 2 88005987 missense probably damaging 1.00
R0685:Olfr1160 UTSW 2 88006418 missense probably damaging 1.00
R1416:Olfr1160 UTSW 2 88006571 missense probably damaging 1.00
R1852:Olfr1160 UTSW 2 88006521 missense probably damaging 1.00
R1965:Olfr1160 UTSW 2 88006304 missense probably damaging 1.00
R2206:Olfr1160 UTSW 2 88006235 missense probably benign 0.00
R4853:Olfr1160 UTSW 2 88006104 missense probably damaging 1.00
R5599:Olfr1160 UTSW 2 88006005 missense probably benign 0.44
R6851:Olfr1160 UTSW 2 88005956 missense probably damaging 0.98
R6995:Olfr1160 UTSW 2 88006185 missense probably benign 0.00
Z1176:Olfr1160 UTSW 2 88006437 missense probably damaging 0.98
Z31818:Olfr1160 UTSW 2 88005890 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTAATGCTGTAAAGCCCATC -3'
(R):5'- TGCTTTGATACCTACACACATGAC -3'

Sequencing Primer
(F):5'- GCTGTAAAGCCCATCGTTAAATAGC -3'
(R):5'- CACACATGACATAATATTGGTGGTG -3'
Posted On2019-12-03