Incidental Mutation 'RF019:Gpr89'
ID603727
Institutional Source Beutler Lab
Gene Symbol Gpr89
Ensembl Gene ENSMUSG00000028096
Gene NameG protein-coupled receptor 89
Synonyms4933412D19Rik, SH120
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #RF019 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96868281-96905346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96905193 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 11 (I11V)
Ref Sequence ENSEMBL: ENSMUSP00000029738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029738] [ENSMUST00000154750] [ENSMUST00000199597]
Predicted Effect probably benign
Transcript: ENSMUST00000029738
AA Change: I11V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029738
Gene: ENSMUSG00000028096
AA Change: I11V

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
Pfam:GPHR_N 140 207 1.1e-31 PFAM
Pfam:ABA_GPCR 276 446 4.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154750
AA Change: I11V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116016
Gene: ENSMUSG00000028096
AA Change: I11V

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199597
SMART Domains Protein: ENSMUSP00000143542
Gene: ENSMUSG00000057123

DomainStartEndE-ValueType
CNX 43 76 3.47e-19 SMART
Connexin_CCC 163 229 2.45e-37 SMART
Pfam:Connexin40_C 257 358 2.4e-33 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 86% (36/42)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A G 1: 138,856,691 S43P probably benign Het
3110021N24Rik AGCGCGGCCGGG AG 4: 108,780,630 probably null Het
4931406P16Rik A G 7: 34,240,549 F918L probably damaging Het
Ankrd11 A G 8: 122,896,634 V294A probably damaging Het
Ciita T A 16: 10,506,747 I181N probably damaging Het
Col6a1 T C 10: 76,711,615 M675V unknown Het
Colec11 A G 12: 28,612,883 V62A probably benign Het
Eif3i T C 4: 129,600,465 T14A probably damaging Het
Filip1l A G 16: 57,570,641 T531A probably benign Het
Fscb GAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT GAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,472,596 probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hivep3 T C 4: 120,098,270 V1261A probably benign Het
Itgad C A 7: 128,192,208 H751N probably benign Het
Krtap28-10 CCACAGCCACAGCCA CCACAGCCACAGCCAACACAGCCACAGCCA 1: 83,042,269 probably benign Het
L1td1 A G 4: 98,736,824 K419E not run Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbtps1 A T 8: 119,525,550 W534R probably damaging Het
Myo9a T C 9: 59,921,772 V2387A probably benign Het
Ncapg C A 5: 45,698,856 P949Q probably benign Het
Nuggc T C 14: 65,648,264 F796S probably damaging Het
Otol1 A T 3: 70,018,600 E36V probably benign Het
Pkhd1l1 TT TTTTTTTTTAT 15: 44,558,507 probably benign Het
Ralgapa2 A G 2: 146,361,503 I1095T possibly damaging Het
Reep1 C CCGCG 6: 71,707,969 probably null Het
Smarca2 GCAGCA GCAGCAACAGCA 19: 26,631,001 probably benign Het
Tcf20 T C 15: 82,851,593 I1886V probably benign Het
Txnrd1 T G 10: 82,885,100 probably null Het
Unc5b A G 10: 60,783,183 V60A probably damaging Het
Vmn1r45 A T 6: 89,933,109 V293E probably damaging Het
Zfhx4 T A 3: 5,403,267 D2853E probably benign Het
Zfp108 G T 7: 24,261,607 R541L probably benign Het
Other mutations in Gpr89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gpr89 APN 3 96898523 missense probably damaging 1.00
IGL00757:Gpr89 APN 3 96871534 missense probably benign 0.00
IGL01114:Gpr89 APN 3 96893549 missense probably damaging 0.98
IGL02417:Gpr89 APN 3 96897425 nonsense probably null
explorer UTSW 3 96880069 splice site probably null
R0207:Gpr89 UTSW 3 96871480 missense probably damaging 0.99
R0650:Gpr89 UTSW 3 96897324 splice site probably benign
R0704:Gpr89 UTSW 3 96880168 critical splice acceptor site probably null
R1496:Gpr89 UTSW 3 96905210 missense probably benign 0.00
R1869:Gpr89 UTSW 3 96875659 missense probably benign 0.16
R1913:Gpr89 UTSW 3 96875633 missense possibly damaging 0.91
R2264:Gpr89 UTSW 3 96872515 missense probably damaging 0.99
R2276:Gpr89 UTSW 3 96897427 missense probably damaging 1.00
R3822:Gpr89 UTSW 3 96892944 missense probably benign 0.03
R3922:Gpr89 UTSW 3 96890899 missense probably damaging 1.00
R4984:Gpr89 UTSW 3 96905196 missense probably benign 0.02
R5761:Gpr89 UTSW 3 96892880 missense probably damaging 1.00
R6185:Gpr89 UTSW 3 96890833 missense probably damaging 0.99
R7063:Gpr89 UTSW 3 96875698 missense probably damaging 1.00
R7164:Gpr89 UTSW 3 96871398 missense probably benign 0.04
R7172:Gpr89 UTSW 3 96880069 splice site probably null
R7215:Gpr89 UTSW 3 96880088 missense probably damaging 1.00
R7536:Gpr89 UTSW 3 96890893 missense probably damaging 0.96
R7708:Gpr89 UTSW 3 96880625 missense possibly damaging 0.81
R7849:Gpr89 UTSW 3 96871490 nonsense probably null
R7932:Gpr89 UTSW 3 96871490 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAAGCTCAGACTTGGACCTC -3'
(R):5'- TCCAGGCAAACGGAGAATGC -3'

Sequencing Primer
(F):5'- GAGGCAAACGTGTCAGCACC -3'
(R):5'- AGAATGCGGCCGCTGATTG -3'
Posted On2019-12-04