Incidental Mutation 'RF033:Nefh'
ID604457
Institutional Source Beutler Lab
Gene Symbol Nefh
Ensembl Gene ENSMUSG00000020396
Gene Nameneurofilament, heavy polypeptide
SynonymsNF-H, NEFH, NF200
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF033 (G1)
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location4938754-4948064 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGGGACTTG to GGGGACTTGTCCTCACCTGGGACTTG at 4941029 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093369]
Predicted Effect probably null
Transcript: ENSMUST00000093369
SMART Domains Protein: ENSMUSP00000091061
Gene: ENSMUSG00000020396

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
Filament 94 410 1.45e-109 SMART
low complexity region 470 515 N/A INTRINSIC
Pfam:DUF1388 519 545 1.8e-14 PFAM
Pfam:DUF1388 536 562 5.8e-15 PFAM
Pfam:DUF1388 542 569 2.7e-12 PFAM
Pfam:DUF1388 578 611 9.7e-10 PFAM
Pfam:DUF1388 602 629 4.9e-14 PFAM
Pfam:DUF1388 608 635 4.7e-14 PFAM
Pfam:DUF1388 626 653 1.4e-13 PFAM
Pfam:DUF1388 632 659 2.5e-13 PFAM
Pfam:DUF1388 656 683 4.4e-14 PFAM
Pfam:DUF1388 680 706 1.5e-12 PFAM
Pfam:DUF1388 700 730 5e-12 PFAM
Pfam:DUF1388 728 755 7.9e-14 PFAM
Pfam:DUF1388 752 779 4.7e-14 PFAM
Pfam:DUF1388 779 800 1.9e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 858 948 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
low complexity region 976 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased axon diameter and transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGTCG 19: 5,425,224 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Arid1b GGGG GGGGGGG 17: 4,995,585 probably benign Het
AY761185 CCCGGGCACT C 8: 20,943,888 probably benign Het
Chga AGC AGCTGC 12: 102,561,396 probably benign Het
Cul9 CCT CCTTCT 17: 46,500,854 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fbrsl1 GTG GTGAGTGTGCTGATG 5: 110,378,125 probably benign Het
Gab3 TTC TTCGTC X: 75,000,001 probably benign Het
Gab3 TCT TCTGCT X: 75,000,023 probably benign Het
Gm47955 TGG TGGTTGTGGCGG 1: 82,960,525 probably benign Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,144 probably null Het
Gm8369 GTGTGT GTGTGTCTGTGT 19: 11,511,778 probably benign Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Il2 GG GGGCTTGGAGTGTG 3: 37,125,842 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTTCAGCTCCAGCT 2: 181,697,588 probably benign Het
Luzp1 A AGGTGTCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 GCA GCATCA X: 71,118,833 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCGAGCTCCAGCTCCAGCTCCA 2: 121,306,299 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l CAG CAGAAG 3: 59,275,987 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 GCAAGCTGAGA GCAAGCTGAGATACACGTTAGCAGTGAGGTTCAAGCTGAGA 2: 119,627,600 probably benign Het
P4ha3 GGGGG GGGGGG 7: 100,310,810 probably null Het
Pdia4 ATCCTCTTCCTC ATC 6: 47,808,288 probably benign Het
Pkhd1l1 TTT TTTTTTTTTTCTT 15: 44,558,506 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 GTATTG GTATTGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,079 probably benign Het
Rbm12 TATTG TATTGTGGGACCAGGTATTGCGGGACCAGGCATTG 2: 156,096,080 probably benign Het
Rbm12 TTG TTGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,082 probably benign Het
Rbm12 TG TGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,083 probably benign Het
Rbm12 G GTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,084 probably benign Het
Thegl ATCCTCCCCAGTCCCGCAAGGCCAG ATCCTCCCCAGTCCCGCAAGGCCAGCGCTCCTCCCCAGTCCCGCAAGGCCAG 5: 77,016,405 probably benign Het
Thegl G GCGATCCTCCCCAGTCCCGCAAGGCCAC 5: 77,016,429 probably benign Het
Tmem28 CG CGCCGCTG X: 99,821,373 probably benign Het
Tmem59 TGTTT TGTTTGTTGGTTT 4: 107,190,528 probably benign Het
Other mutations in Nefh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Nefh APN 11 4941356 missense possibly damaging 0.71
IGL03025:Nefh APN 11 4945289 missense probably damaging 0.99
FR4340:Nefh UTSW 11 4941033 small insertion probably benign
FR4340:Nefh UTSW 11 4941038 small insertion probably benign
FR4340:Nefh UTSW 11 4941040 small insertion probably benign
R0041:Nefh UTSW 11 4945184 missense possibly damaging 0.92
R0149:Nefh UTSW 11 4940799 missense probably benign 0.39
R0361:Nefh UTSW 11 4940799 missense probably benign 0.39
R0531:Nefh UTSW 11 4940240 missense probably damaging 1.00
R1340:Nefh UTSW 11 4941002 small insertion probably benign
R1349:Nefh UTSW 11 4941010 small insertion probably benign
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1564:Nefh UTSW 11 4939878 missense unknown
R2165:Nefh UTSW 11 4943872 missense probably damaging 1.00
R2417:Nefh UTSW 11 4939479 missense unknown
R2906:Nefh UTSW 11 4940216 missense probably benign 0.15
R3750:Nefh UTSW 11 4939937 missense probably benign 0.33
R4298:Nefh UTSW 11 4940066 missense probably benign
R4462:Nefh UTSW 11 4941015 missense probably damaging 0.98
R4713:Nefh UTSW 11 4939656 missense unknown
R4878:Nefh UTSW 11 4941333 missense probably damaging 0.98
R5423:Nefh UTSW 11 4940985 missense possibly damaging 0.59
R5648:Nefh UTSW 11 4945233 missense probably damaging 1.00
R5893:Nefh UTSW 11 4941323 missense probably damaging 1.00
R6459:Nefh UTSW 11 4939551 missense unknown
R7583:Nefh UTSW 11 4941089 missense probably damaging 0.96
R7925:Nefh UTSW 11 4940972 small deletion probably benign
RF001:Nefh UTSW 11 4941030 small insertion probably benign
RF002:Nefh UTSW 11 4941047 small insertion probably benign
RF002:Nefh UTSW 11 4941050 small insertion probably benign
RF009:Nefh UTSW 11 4940997 small insertion probably benign
RF012:Nefh UTSW 11 4941030 small insertion probably benign
RF012:Nefh UTSW 11 4941032 small insertion probably benign
RF012:Nefh UTSW 11 4941055 small insertion probably benign
RF013:Nefh UTSW 11 4941032 small insertion probably benign
RF016:Nefh UTSW 11 4941022 small insertion probably benign
RF016:Nefh UTSW 11 4941023 small insertion probably benign
RF025:Nefh UTSW 11 4941003 small insertion probably benign
RF025:Nefh UTSW 11 4941029 small insertion probably benign
RF028:Nefh UTSW 11 4941012 small insertion probably benign
RF028:Nefh UTSW 11 4941029 small insertion probably benign
RF033:Nefh UTSW 11 4941039 small insertion probably benign
RF035:Nefh UTSW 11 4941039 small insertion probably benign
RF036:Nefh UTSW 11 4941010 small insertion probably benign
RF036:Nefh UTSW 11 4941016 small insertion probably benign
RF036:Nefh UTSW 11 4941036 small insertion probably benign
RF036:Nefh UTSW 11 4941048 small insertion probably benign
RF037:Nefh UTSW 11 4940999 small insertion probably benign
RF037:Nefh UTSW 11 4941046 small insertion probably benign
RF037:Nefh UTSW 11 4941054 small insertion probably benign
RF038:Nefh UTSW 11 4941012 small insertion probably benign
RF038:Nefh UTSW 11 4941018 small insertion probably benign
RF038:Nefh UTSW 11 4941019 small insertion probably benign
RF038:Nefh UTSW 11 4941027 small insertion probably benign
RF038:Nefh UTSW 11 4941029 small insertion probably benign
RF038:Nefh UTSW 11 4941040 small insertion probably benign
RF039:Nefh UTSW 11 4941007 small insertion probably benign
RF041:Nefh UTSW 11 4941039 small insertion probably benign
RF043:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941021 small insertion probably benign
RF044:Nefh UTSW 11 4941023 small insertion probably benign
RF047:Nefh UTSW 11 4941038 small insertion probably benign
RF048:Nefh UTSW 11 4941003 small insertion probably benign
RF048:Nefh UTSW 11 4941007 small insertion probably benign
RF049:Nefh UTSW 11 4940997 small insertion probably benign
RF051:Nefh UTSW 11 4941054 small insertion probably benign
RF053:Nefh UTSW 11 4941014 nonsense probably null
RF054:Nefh UTSW 11 4941048 small insertion probably benign
RF055:Nefh UTSW 11 4941004 small insertion probably benign
RF058:Nefh UTSW 11 4941021 small insertion probably benign
RF060:Nefh UTSW 11 4941050 small insertion probably benign
RF060:Nefh UTSW 11 4941052 small insertion probably benign
RF062:Nefh UTSW 11 4941028 small insertion probably benign
T0975:Nefh UTSW 11 4940151 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTAGCTGGAGACTTGGG -3'
(R):5'- ATTGGCTTTGGTCCGAGTCC -3'

Sequencing Primer
(F):5'- ACTTGGGCTCAGCTGGTGAC -3'
(R):5'- TCTTACTGAAGGACTCCCAAAAATTC -3'
Posted On2019-12-04