Incidental Mutation 'RF033:Chga'
ID604459
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF033 (G1)
Quality Score183.468
Status Not validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGC to AGCTGC at 102561396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably benign
Transcript: ENSMUST00000021610
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGTCG 19: 5,425,224 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Arid1b GGGG GGGGGGG 17: 4,995,585 probably benign Het
AY761185 CCCGGGCACT C 8: 20,943,888 probably benign Het
Cul9 CCT CCTTCT 17: 46,500,854 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fbrsl1 GTG GTGAGTGTGCTGATG 5: 110,378,125 probably benign Het
Gab3 TTC TTCGTC X: 75,000,001 probably benign Het
Gab3 TCT TCTGCT X: 75,000,023 probably benign Het
Gm47955 TGG TGGTTGTGGCGG 1: 82,960,525 probably benign Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,144 probably null Het
Gm8369 GTGTGT GTGTGTCTGTGT 19: 11,511,778 probably benign Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Il2 GG GGGCTTGGAGTGTG 3: 37,125,842 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTTCAGCTCCAGCT 2: 181,697,588 probably benign Het
Luzp1 A AGGTGTCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 GCA GCATCA X: 71,118,833 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCGAGCTCCAGCTCCAGCTCCA 2: 121,306,299 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l CAG CAGAAG 3: 59,275,987 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nefh GGGGACTTG GGGGACTTGTCCTCACCTGGGACTTG 11: 4,941,029 probably null Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGACTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 GCAAGCTGAGA GCAAGCTGAGATACACGTTAGCAGTGAGGTTCAAGCTGAGA 2: 119,627,600 probably benign Het
P4ha3 GGGGG GGGGGG 7: 100,310,810 probably null Het
Pdia4 ATCCTCTTCCTC ATC 6: 47,808,288 probably benign Het
Pkhd1l1 TTT TTTTTTTTTTCTT 15: 44,558,506 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 GTATTG GTATTGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,079 probably benign Het
Rbm12 TATTG TATTGTGGGACCAGGTATTGCGGGACCAGGCATTG 2: 156,096,080 probably benign Het
Rbm12 TTG TTGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,082 probably benign Het
Rbm12 TG TGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,083 probably benign Het
Rbm12 G GTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,084 probably benign Het
Thegl ATCCTCCCCAGTCCCGCAAGGCCAG ATCCTCCCCAGTCCCGCAAGGCCAGCGCTCCTCCCCAGTCCCGCAAGGCCAG 5: 77,016,405 probably benign Het
Thegl G GCGATCCTCCCCAGTCCCGCAAGGCCAC 5: 77,016,429 probably benign Het
Tmem28 CG CGCCGCTG X: 99,821,373 probably benign Het
Tmem59 TGTTT TGTTTGTTGGTTT 4: 107,190,528 probably benign Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R3696:Chga UTSW 12 102561465 missense probably damaging 0.98
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5507:Chga UTSW 12 102562609 missense probably benign 0.39
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
R7694:Chga UTSW 12 102561347 missense probably benign 0.05
R8084:Chga UTSW 12 102562069 missense probably benign 0.29
R8211:Chga UTSW 12 102561419 missense possibly damaging 0.71
RF001:Chga UTSW 12 102561423 small insertion probably benign
RF002:Chga UTSW 12 102561421 small insertion probably benign
RF006:Chga UTSW 12 102561412 small insertion probably benign
RF009:Chga UTSW 12 102561420 small insertion probably benign
RF010:Chga UTSW 12 102561403 small insertion probably benign
RF014:Chga UTSW 12 102561393 small insertion probably benign
RF014:Chga UTSW 12 102561405 small insertion probably benign
RF015:Chga UTSW 12 102561420 small insertion probably benign
RF022:Chga UTSW 12 102561420 small insertion probably benign
RF035:Chga UTSW 12 102561427 small insertion probably benign
RF044:Chga UTSW 12 102561396 small insertion probably benign
RF048:Chga UTSW 12 102561403 small insertion probably benign
RF048:Chga UTSW 12 102561421 small insertion probably benign
RF049:Chga UTSW 12 102561393 small insertion probably benign
RF052:Chga UTSW 12 102561416 small insertion probably benign
RF054:Chga UTSW 12 102561423 small insertion probably benign
RF056:Chga UTSW 12 102561424 small insertion probably benign
RF058:Chga UTSW 12 102561416 small insertion probably benign
RF060:Chga UTSW 12 102561424 small insertion probably benign
RF061:Chga UTSW 12 102561413 small insertion probably benign
RF061:Chga UTSW 12 102561427 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGTAGAACTTTCTCACATTTCCCAC -3'
(R):5'- CTTCCTGCTGTGAAGAAGCAG -3'

Sequencing Primer
(F):5'- GACACTGAGTCAGAGGGGTG -3'
(R):5'- CTGTGAAGAAGCAGCATCACCTG -3'
Posted On2019-12-04