Incidental Mutation 'R2086:Golm1'
ID230017
Institutional Source Beutler Lab
Gene Symbol Golm1
Ensembl Gene ENSMUSG00000021556
Gene Namegolgi membrane protein 1
Synonyms2310001L02Rik, GP73, PSEC0257, D030064E01Rik, Golph2
MMRRC Submission 040091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2086 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59634626-59675811 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 59645185 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 169 (Q169*)
Ref Sequence ENSEMBL: ENSMUSP00000093410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022039] [ENSMUST00000095739]
Predicted Effect probably null
Transcript: ENSMUST00000022039
AA Change: Q169*
SMART Domains Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556
AA Change: Q169*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095739
AA Change: Q169*
SMART Domains Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556
AA Change: Q169*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225333
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533L02Rik T C 7: 125,318,595 M53T unknown Het
Abcb11 T A 2: 69,259,476 probably benign Het
Acap2 C G 16: 31,110,945 A432P probably damaging Het
Adamtsl1 A G 4: 86,228,012 R302G probably damaging Het
Ap2b1 T G 11: 83,351,118 S608A possibly damaging Het
Atp13a3 T A 16: 30,352,298 T310S possibly damaging Het
Atp6v1b1 T C 6: 83,757,852 V382A probably benign Het
Atp6v1g1 T A 4: 63,550,067 F102L probably benign Het
B430306N03Rik T A 17: 48,316,782 V37D probably damaging Het
Cacna1d T C 14: 30,047,357 Y1872C possibly damaging Het
Carf T A 1: 60,109,411 Y54N probably damaging Het
Cct5 T C 15: 31,594,203 E256G probably damaging Het
Cd5 A G 19: 10,723,256 S295P probably benign Het
Cenpb T C 2: 131,178,597 probably benign Het
Cntnap3 A G 13: 64,794,262 M218T possibly damaging Het
Colec11 C T 12: 28,594,787 R236H probably damaging Het
Crem T A 18: 3,288,098 probably benign Het
Csnk2a1 A G 2: 152,254,281 N58S probably benign Het
Cyp2a4 T G 7: 26,312,308 M318R probably damaging Het
Dhrs1 T A 14: 55,743,659 Q98L probably null Het
Dnah11 G T 12: 118,113,871 Q1296K possibly damaging Het
Doxl2 A G 6: 48,977,602 E558G probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Eid2b C T 7: 28,277,773 probably benign Het
Exoc1 A T 5: 76,532,846 K28* probably null Het
Fam114a1 A G 5: 64,980,059 D115G probably benign Het
Fam151a A T 4: 106,735,563 probably null Het
Gc T C 5: 89,438,342 Y313C probably damaging Het
Gdpd1 A G 11: 87,035,268 Y284H probably benign Het
Gm21957 T A 7: 125,219,706 noncoding transcript Het
Greb1l T C 18: 10,523,281 V813A probably damaging Het
Itih1 C T 14: 30,937,843 A279T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 T C 17: 67,817,623 C2893R probably damaging Het
Lama3 T A 18: 12,524,830 N334K probably benign Het
Loxhd1 A G 18: 77,384,946 D1053G probably damaging Het
Map3k20 A G 2: 72,398,385 K316R probably benign Het
Mapre3 A C 5: 30,863,202 probably null Het
Mfsd7a C T 5: 108,445,621 R117H probably damaging Het
Mgam T A 6: 40,761,028 probably null Het
Mical2 A C 7: 112,318,603 H389P probably benign Het
Mtmr2 A G 9: 13,799,952 D347G probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nodal A T 10: 61,423,298 E171D possibly damaging Het
Notch2 T C 3: 98,102,367 S537P probably damaging Het
Obox6 A G 7: 15,833,607 L305S probably damaging Het
Obscn T C 11: 59,078,256 D2715G probably damaging Het
Olfr154 A C 2: 85,663,746 S229R probably benign Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Pcca T C 14: 122,686,115 S404P probably damaging Het
Pcdh10 T C 3: 45,380,471 S407P probably damaging Het
Plekha5 C A 6: 140,570,318 probably null Het
Ptdss1 A G 13: 66,953,555 N72S probably benign Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Pygm G A 19: 6,391,481 probably null Het
Rab7 C T 6: 88,012,318 V57I probably benign Het
Rasl10a A G 11: 5,059,431 probably null Het
Rergl T C 6: 139,494,834 T106A probably benign Het
Rnf17 T G 14: 56,483,380 V1023G probably damaging Het
Rnf25 T A 1: 74,593,967 R409W probably damaging Het
Rps6ka1 T C 4: 133,872,969 M1V probably null Het
Rps6ka5 T C 12: 100,619,615 T140A possibly damaging Het
Sbno2 T A 10: 80,057,856 I1204F possibly damaging Het
Serpina16 A T 12: 103,675,262 I68N probably damaging Het
Slc35a5 A G 16: 45,144,265 S202P probably damaging Het
Slc35g3 G C 11: 69,760,946 S93W probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Spag1 T C 15: 36,227,141 L648P probably damaging Het
Tagap1 T C 17: 6,956,703 D198G probably benign Het
Tedc2 T C 17: 24,217,900 E287G probably damaging Het
Tjp1 C A 7: 65,312,921 R1089S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ttc38 T A 15: 85,838,727 D125E probably benign Het
Uggt1 C T 1: 36,192,414 R490Q probably null Het
Uroc1 T G 6: 90,344,114 L224R probably damaging Het
Vmn1r228 A T 17: 20,777,193 I21N possibly damaging Het
Vmn2r102 T G 17: 19,676,687 L99V probably damaging Het
Vps13c C T 9: 67,950,289 S2601F probably benign Het
Zfp462 T C 4: 55,010,830 L932P probably damaging Het
Other mutations in Golm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Golm1 APN 13 59649656 missense probably damaging 0.99
IGL01327:Golm1 APN 13 59645144 missense possibly damaging 0.95
IGL02348:Golm1 APN 13 59638377 missense probably benign 0.00
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0458:Golm1 UTSW 13 59664364 missense probably damaging 0.98
R0989:Golm1 UTSW 13 59640183 missense probably benign 0.01
R1301:Golm1 UTSW 13 59638373 missense probably damaging 0.99
R1804:Golm1 UTSW 13 59642389 critical splice acceptor site probably null
R1905:Golm1 UTSW 13 59642251 missense probably benign 0.04
R1940:Golm1 UTSW 13 59642237 splice site probably benign
R2513:Golm1 UTSW 13 59642258 missense probably benign 0.01
R2887:Golm1 UTSW 13 59640230 missense probably benign 0.00
R3903:Golm1 UTSW 13 59638340 missense probably damaging 1.00
R4154:Golm1 UTSW 13 59642353 missense probably benign 0.01
R5580:Golm1 UTSW 13 59642365 missense probably benign 0.03
R6193:Golm1 UTSW 13 59645158 missense probably benign 0.00
R6418:Golm1 UTSW 13 59665561 missense probably damaging 1.00
R6594:Golm1 UTSW 13 59664227 missense possibly damaging 0.79
R6604:Golm1 UTSW 13 59638383 missense probably damaging 1.00
R6967:Golm1 UTSW 13 59649576 small deletion probably benign
R6968:Golm1 UTSW 13 59649576 small deletion probably benign
R6991:Golm1 UTSW 13 59649576 small deletion probably benign
R6992:Golm1 UTSW 13 59649576 small deletion probably benign
R6993:Golm1 UTSW 13 59649576 small deletion probably benign
R6996:Golm1 UTSW 13 59642244 missense probably benign 0.00
R7576:Golm1 UTSW 13 59645106 missense probably benign 0.00
R7692:Golm1 UTSW 13 59640257 missense probably benign 0.08
R7863:Golm1 UTSW 13 59649569 missense probably damaging 1.00
R7946:Golm1 UTSW 13 59649569 missense probably damaging 1.00
X0026:Golm1 UTSW 13 59638313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGCTCTGTTGTACCACAG -3'
(R):5'- TTGAATGGTTGCAGATGGACAC -3'

Sequencing Primer
(F):5'- TGCTCTGTTGTACCACAGAGAAC -3'
(R):5'- TTGCAGATGGACACTTGCC -3'
Posted On2014-09-18