Incidental Mutation 'R7874:Srrm2'
ID608350
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7874 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23815678 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 432 (R432H)
Ref Sequence ENSEMBL: ENSMUSP00000085993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088621] [ENSMUST00000190686]
Predicted Effect unknown
Transcript: ENSMUST00000088621
AA Change: R432H
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: R432H

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186045
Predicted Effect unknown
Transcript: ENSMUST00000190686
AA Change: R528H
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: R528H

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C A 3: 6,620,141 K84N probably damaging Het
Aacs T C 5: 125,506,207 F276L possibly damaging Het
Aicda T A 6: 122,561,949 I179N probably damaging Het
Anks6 T A 4: 47,049,275 H210L unknown Het
Ano1 G A 7: 144,621,724 R486W probably damaging Het
Atp8b1 A G 18: 64,571,024 V341A probably benign Het
AY761184 C A 8: 21,702,796 R61S possibly damaging Het
Btn1a1 T C 13: 23,459,215 T355A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Ceacam19 A T 7: 19,886,438 D89E probably damaging Het
Cerkl T A 2: 79,338,637 R407S probably damaging Het
Chl1 A G 6: 103,690,263 T389A probably benign Het
Dcn A G 10: 97,510,194 probably null Het
Dhtkd1 T C 2: 5,917,674 Q558R possibly damaging Het
Dhx36 C A 3: 62,488,631 V452L probably benign Het
Dlg5 A G 14: 24,135,619 V1906A probably damaging Het
Emc4 T C 2: 112,363,833 T159A probably damaging Het
Fstl5 C A 3: 76,661,786 P582Q probably benign Het
Gm960 C T 19: 4,658,423 C347Y probably damaging Het
Izumo1r T A 9: 14,900,579 Y171F probably benign Het
Jag2 C T 12: 112,915,946 V401M probably damaging Het
Jph2 C T 2: 163,375,842 G305S probably damaging Het
Kbtbd13 C A 9: 65,390,302 V451L probably benign Het
Map3k12 T C 15: 102,500,642 T813A possibly damaging Het
Mast4 A G 13: 102,739,275 L1295P probably damaging Het
Mia2 T A 12: 59,108,588 D362E probably damaging Het
Mospd3 T C 5: 137,600,028 Y77C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mup8 T A 4: 60,222,420 H17L probably damaging Het
Naip2 C T 13: 100,154,951 D1160N not run Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ndnf A T 6: 65,703,429 M231L probably benign Het
Obscn T G 11: 59,133,276 T523P probably damaging Het
Olfr325 T C 11: 58,581,747 V301A possibly damaging Het
P4htm G T 9: 108,596,949 A130E probably benign Het
Phc3 A T 3: 30,936,714 D439E probably benign Het
Phlpp1 A G 1: 106,389,873 I1275V probably benign Het
Poln A T 5: 34,024,350 I719N probably damaging Het
Ptch2 T A 4: 117,105,964 L216Q possibly damaging Het
Rarres2 T A 6: 48,572,145 K41N probably benign Het
Rasal3 C T 17: 32,396,707 E386K possibly damaging Het
Rev3l T C 10: 39,822,495 I996T possibly damaging Het
Rreb1 A G 13: 37,947,124 N36S probably damaging Het
Serpinb9d T A 13: 33,202,671 probably null Het
Slc14a2 A G 18: 78,160,768 V526A probably benign Het
Slc45a4 T C 15: 73,584,335 probably null Het
Svs1 A G 6: 48,988,666 N536S possibly damaging Het
Th G A 7: 142,895,571 R266* probably null Het
Tln1 T C 4: 43,538,041 Y1853C probably damaging Het
Tln1 A T 4: 43,555,606 D169E probably damaging Het
Tmcc3 G A 10: 94,551,027 probably null Het
Tnxb A G 17: 34,711,443 E2034G probably damaging Het
Ttc4 T C 4: 106,665,684 T346A probably benign Het
Vmn2r5 A T 3: 64,491,032 V842E probably damaging Het
Vmn2r82 T G 10: 79,396,511 N781K probably damaging Het
Zdhhc17 A T 10: 110,982,117 Y67N possibly damaging Het
Zfp273 A G 13: 67,825,439 T229A probably benign Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zswim8 A G 14: 20,723,149 H1769R probably damaging Het
Zzef1 T C 11: 72,859,653 V929A probably benign Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
BB009:Srrm2 UTSW 17 23818527 missense probably benign 0.23
BB019:Srrm2 UTSW 17 23818527 missense probably benign 0.23
R0173:Srrm2 UTSW 17 23815129 unclassified probably benign
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1618:Srrm2 UTSW 17 23818932 unclassified probably benign
R1678:Srrm2 UTSW 17 23818986 missense probably benign 0.23
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2094:Srrm2 UTSW 17 23812429 unclassified probably benign
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5197:Srrm2 UTSW 17 23817384 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R6906:Srrm2 UTSW 17 23820363 missense probably damaging 0.97
R7084:Srrm2 UTSW 17 23820316 missense probably damaging 0.99
R7177:Srrm2 UTSW 17 23816773 missense unknown
R7197:Srrm2 UTSW 17 23818224 missense unknown
R7442:Srrm2 UTSW 17 23820117 missense unknown
R7644:Srrm2 UTSW 17 23819320 missense unknown
R7664:Srrm2 UTSW 17 23820981 missense probably damaging 0.99
R7932:Srrm2 UTSW 17 23818527 missense probably benign 0.23
R7950:Srrm2 UTSW 17 23808110 missense unknown
R7958:Srrm2 UTSW 17 23821312 missense probably benign 0.25
R8081:Srrm2 UTSW 17 23820245 missense probably damaging 1.00
R8118:Srrm2 UTSW 17 23808083 missense unknown
R8174:Srrm2 UTSW 17 23815323 missense unknown
R8191:Srrm2 UTSW 17 23820245 missense probably damaging 1.00
R8334:Srrm2 UTSW 17 23808356 missense unknown
RF006:Srrm2 UTSW 17 23812588 missense unknown
Z1176:Srrm2 UTSW 17 23817183 missense unknown
Z1177:Srrm2 UTSW 17 23817510 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGAATCGCTCGCATGGCAG -3'
(R):5'- TGGATCGTGATCTTCGCCTG -3'

Sequencing Primer
(F):5'- GCAAAGCGGGATAAATCTCATTCTC -3'
(R):5'- TGATCTTCGCCTGGCAGG -3'
Posted On2019-12-20