Incidental Mutation 'R8191:Srrm2'
ID635188
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R8191 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23820245 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1954 (N1954K)
Ref Sequence ENSEMBL: ENSMUSP00000085993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069579] [ENSMUST00000088621] [ENSMUST00000190686]
Predicted Effect probably benign
Transcript: ENSMUST00000069579
SMART Domains Protein: ENSMUSP00000066210
Gene: ENSMUSG00000055839

DomainStartEndE-ValueType
UBQ 3 80 5.1e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088621
AA Change: N1954K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: N1954K

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186259
Predicted Effect probably damaging
Transcript: ENSMUST00000190686
AA Change: N2050K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: N2050K

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,931,001 N100K probably damaging Het
1700037C18Rik G A 16: 3,907,054 R49W probably damaging Het
Adamts4 T C 1: 171,252,723 S282P Het
AI314180 A T 4: 58,872,587 probably null Het
Aqp4 A G 18: 15,398,165 S180P probably benign Het
Armc2 T G 10: 41,963,751 E406A probably benign Het
Atp13a3 A T 16: 30,349,780 Y464N probably damaging Het
B3gnt3 C A 8: 71,693,478 V136L probably benign Het
Cacna1s C T 1: 136,108,155 H1378Y probably damaging Het
Ccnk A T 12: 108,193,674 E138D probably benign Het
Cenpe A G 3: 135,251,614 K1878E probably benign Het
Cep57l1 T A 10: 41,740,959 I111L probably damaging Het
Copg2 T C 6: 30,813,730 I509V probably benign Het
Cux2 T A 5: 121,874,154 D406V probably benign Het
Cyp2a12 G T 7: 27,031,104 A165S probably benign Het
Dnaaf5 T G 5: 139,181,495 S719A probably benign Het
Dnah7c A G 1: 46,607,458 I1220V possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dusp10 T A 1: 184,037,552 D238E possibly damaging Het
Dync1li1 C A 9: 114,709,185 D203E probably benign Het
Eif5b T C 1: 38,036,202 S587P probably damaging Het
Ephb2 G A 4: 136,658,945 T832I probably damaging Het
Exoc1 T A 5: 76,559,827 probably null Het
Fam193a T A 5: 34,440,573 N571K probably damaging Het
Fem1a T A 17: 56,258,356 I483N probably damaging Het
Fgf20 C A 8: 40,308,320 probably benign Het
Fkbp1a C T 2: 151,557,436 P98S Het
Gm9833 G T 3: 10,088,854 V228F probably damaging Het
Gpsm3 A T 17: 34,590,477 D19V probably benign Het
Ido2 C A 8: 24,533,680 G381W probably damaging Het
Ifi204 T C 1: 173,751,660 T540A possibly damaging Het
Isl1 A T 13: 116,305,418 M93K probably benign Het
Map3k10 T A 7: 27,663,246 S472C probably damaging Het
Mcrs1 A T 15: 99,243,325 V432E probably damaging Het
Metap2 A G 10: 93,865,405 probably null Het
Muc5b A G 7: 141,867,684 S4304G probably benign Het
Nell1 T C 7: 50,448,874 V308A unknown Het
Olfr1511 A G 14: 52,390,530 V81A probably benign Het
Olfr984 A T 9: 40,101,471 H6Q probably benign Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Pnpla6 T C 8: 3,542,382 S1224P probably benign Het
Ripk4 A G 16: 97,763,526 probably benign Het
Rnpep T C 1: 135,272,434 E261G possibly damaging Het
Robo1 C A 16: 72,933,254 S194R probably damaging Het
Rpusd1 C G 17: 25,728,637 Y99* probably null Het
Scarf1 T C 11: 75,522,239 M437T probably benign Het
Sh3tc2 G T 18: 61,973,358 D153Y probably damaging Het
Siglec1 T C 2: 131,085,679 Y69C probably damaging Het
Slc25a34 T C 4: 141,620,584 Y262C probably damaging Het
St6galnac2 T C 11: 116,681,922 Y236C probably damaging Het
Stac3 T A 10: 127,508,199 I322N probably damaging Het
Tcaf1 T C 6: 42,675,256 Q764R probably damaging Het
Tcf20 G A 15: 82,853,405 R1282* probably null Het
Tlr2 T A 3: 83,836,514 K754M probably damaging Het
Tlr2 T G 3: 83,836,515 K754Q probably damaging Het
Tnn C T 1: 160,125,518 V651M probably damaging Het
Ttn T C 2: 76,870,739 H9622R unknown Het
Tubgcp6 C T 15: 89,120,640 G259S probably damaging Het
Ubr5 C A 15: 38,006,507 C1174F Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Vit C T 17: 78,546,399 H25Y probably benign Het
Vmn1r177 G A 7: 23,866,311 Q47* probably null Het
Vmn2r104 A T 17: 20,030,203 V602D possibly damaging Het
Vmn2r115 A G 17: 23,359,556 T668A probably damaging Het
Vmn2r125 T G 4: 156,351,414 C362W probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Wdr63 G T 3: 146,094,311 P158H probably damaging Het
Xpa C A 4: 46,183,225 R188L possibly damaging Het
Zfp143 C T 7: 110,077,157 T249I probably damaging Het
Zfp607a A G 7: 27,879,443 E646G possibly damaging Het
Zfp729a A T 13: 67,621,719 S130R probably benign Het
Zswim3 C A 2: 164,820,208 Q203K probably damaging Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
BB009:Srrm2 UTSW 17 23818527 missense probably benign 0.23
BB019:Srrm2 UTSW 17 23818527 missense probably benign 0.23
R0173:Srrm2 UTSW 17 23815129 unclassified probably benign
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1618:Srrm2 UTSW 17 23818932 unclassified probably benign
R1678:Srrm2 UTSW 17 23818986 missense probably benign 0.23
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2094:Srrm2 UTSW 17 23812429 unclassified probably benign
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5197:Srrm2 UTSW 17 23817384 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R6906:Srrm2 UTSW 17 23820363 missense probably damaging 0.97
R7084:Srrm2 UTSW 17 23820316 missense probably damaging 0.99
R7177:Srrm2 UTSW 17 23816773 missense unknown
R7197:Srrm2 UTSW 17 23818224 missense unknown
R7442:Srrm2 UTSW 17 23820117 missense unknown
R7644:Srrm2 UTSW 17 23819320 missense unknown
R7664:Srrm2 UTSW 17 23820981 missense probably damaging 0.99
R7874:Srrm2 UTSW 17 23815678 missense unknown
R7932:Srrm2 UTSW 17 23818527 missense probably benign 0.23
R7950:Srrm2 UTSW 17 23808110 missense unknown
R7958:Srrm2 UTSW 17 23821312 missense probably benign 0.25
R8081:Srrm2 UTSW 17 23820245 missense probably damaging 1.00
R8118:Srrm2 UTSW 17 23808083 missense unknown
R8174:Srrm2 UTSW 17 23815323 missense unknown
R8334:Srrm2 UTSW 17 23808356 missense unknown
RF006:Srrm2 UTSW 17 23812588 missense unknown
Z1176:Srrm2 UTSW 17 23817183 missense unknown
Z1177:Srrm2 UTSW 17 23817510 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCTAGGTCTCGGACACCACTG -3'
(R):5'- ATCAGGAATCCGAGGACCTG -3'

Sequencing Primer
(F):5'- TCGGACACCACTGTTGCCAC -3'
(R):5'- GAATCCGAGGACCTGGACCATC -3'
Posted On2020-07-13