Incidental Mutation 'R2094:Srrm2'
ID231999
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 23812429 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088621] [ENSMUST00000186961] [ENSMUST00000190686] [ENSMUST00000191385]
Predicted Effect unknown
Transcript: ENSMUST00000088621
AA Change: S183P
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: S183P

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186045
Predicted Effect probably benign
Transcript: ENSMUST00000186961
SMART Domains Protein: ENSMUSP00000140813
Gene: ENSMUSG00000039218

DomainStartEndE-ValueType
cwf21 58 103 5.6e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190293
Predicted Effect unknown
Transcript: ENSMUST00000190686
AA Change: S279P
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: S279P

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191385
Meta Mutation Damage Score 0.1120 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
BB009:Srrm2 UTSW 17 23818527 missense probably benign 0.23
BB019:Srrm2 UTSW 17 23818527 missense probably benign 0.23
R0173:Srrm2 UTSW 17 23815129 unclassified probably benign
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1618:Srrm2 UTSW 17 23818932 unclassified probably benign
R1678:Srrm2 UTSW 17 23818986 missense probably benign 0.23
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5197:Srrm2 UTSW 17 23817384 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R6906:Srrm2 UTSW 17 23820363 missense probably damaging 0.97
R7084:Srrm2 UTSW 17 23820316 missense probably damaging 0.99
R7177:Srrm2 UTSW 17 23816773 missense unknown
R7197:Srrm2 UTSW 17 23818224 missense unknown
R7442:Srrm2 UTSW 17 23820117 missense unknown
R7644:Srrm2 UTSW 17 23819320 missense unknown
R7664:Srrm2 UTSW 17 23820981 missense probably damaging 0.99
R7874:Srrm2 UTSW 17 23815678 missense unknown
R7932:Srrm2 UTSW 17 23818527 missense probably benign 0.23
R7950:Srrm2 UTSW 17 23808110 missense unknown
R7958:Srrm2 UTSW 17 23821312 missense probably benign 0.25
R8081:Srrm2 UTSW 17 23820245 missense probably damaging 1.00
R8118:Srrm2 UTSW 17 23808083 missense unknown
R8174:Srrm2 UTSW 17 23815323 missense unknown
R8191:Srrm2 UTSW 17 23820245 missense probably damaging 1.00
R8334:Srrm2 UTSW 17 23808356 missense unknown
R8523:Srrm2 UTSW 17 23808515 unclassified probably benign
R8728:Srrm2 UTSW 17 23819857 missense unknown
RF006:Srrm2 UTSW 17 23812588 missense unknown
Z1176:Srrm2 UTSW 17 23817183 missense unknown
Z1177:Srrm2 UTSW 17 23817510 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCATGTGACTAAGAACGTTTGT -3'
(R):5'- TCCCTGAGTAAATAAATCCCTGCA -3'

Sequencing Primer
(F):5'- AGAACGTTTGTTTATTGTTTTGTTGG -3'
(R):5'- TCTTTGTCTTCATAAGGACTGCTAG -3'
Posted On2014-09-18