Incidental Mutation 'R0680:Pcdhb18'
ID61769
Institutional Source Beutler Lab
Gene Symbol Pcdhb18
Ensembl Gene ENSMUSG00000048347
Gene Nameprotocadherin beta 18
SynonymsPcdhbR, Pcdhb9
MMRRC Submission 038865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R0680 (G1)
Quality Score166
Status Not validated
Chromosome18
Chromosomal Location37489465-37494505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 37490294 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 226 (A226P)
Ref Sequence ENSEMBL: ENSMUSP00000052113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053856
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055949
AA Change: A226P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347
AA Change: A226P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik T A 10: 3,125,133 noncoding transcript Het
AI481877 T C 4: 59,043,967 D1449G probably benign Het
Clca4a A T 3: 144,969,367 F167L probably damaging Het
Col6a3 T C 1: 90,778,981 M2137V unknown Het
Dennd2a A T 6: 39,483,062 L703Q probably damaging Het
Fsip2 T A 2: 82,991,359 I5812N possibly damaging Het
Gen1 T A 12: 11,241,869 S640C probably benign Het
Il9 T C 13: 56,481,880 T61A probably benign Het
Lrp1 A G 10: 127,589,661 L700P probably damaging Het
Lyst G A 13: 13,650,341 V1514I probably benign Het
Med1 A T 11: 98,180,166 probably null Het
Olfr1205 A T 2: 88,831,780 Y221F probably benign Het
Olfr298 A T 7: 86,489,337 F71L probably benign Het
Olfr666 A G 7: 104,893,004 I208T probably benign Het
Olfr810 T A 10: 129,790,818 Y257F probably damaging Het
Pirb T A 7: 3,717,361 N338Y possibly damaging Het
Rc3h2 A C 2: 37,399,835 I360R probably damaging Het
Rnf139 T C 15: 58,899,652 Y509H probably damaging Het
Shisa7 T A 7: 4,831,723 D279V probably benign Het
Slc6a3 T C 13: 73,538,727 L71P probably damaging Het
Slc9a5 T A 8: 105,355,907 L268Q probably null Het
St7 T C 6: 17,942,733 S563P probably damaging Het
Stx1b A G 7: 127,807,723 V240A possibly damaging Het
Sugt1 A G 14: 79,610,311 I200M possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ube4a T A 9: 44,948,060 Q380L probably damaging Het
Ugt1a2 A G 1: 88,201,211 Y192C probably damaging Het
Unc93b1 G A 19: 3,947,093 V505I probably benign Het
Usp29 T C 7: 6,962,885 S576P possibly damaging Het
Vcan A T 13: 89,679,822 H2208Q probably damaging Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp106 T A 2: 120,527,016 S1133C probably damaging Het
Zfp148 A G 16: 33,495,804 D282G possibly damaging Het
Zswim9 A C 7: 13,260,321 V636G probably benign Het
Other mutations in Pcdhb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Pcdhb18 APN 18 37491931 missense probably benign 0.35
IGL02651:Pcdhb18 APN 18 37491181 nonsense probably null
IGL02721:Pcdhb18 APN 18 37490031 missense probably benign 0.33
IGL02945:Pcdhb18 APN 18 37489995 missense probably benign 0.34
IGL03030:Pcdhb18 APN 18 37490733 missense probably damaging 1.00
IGL03346:Pcdhb18 APN 18 37489621 start codon destroyed probably null 0.99
R0206:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0208:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R1517:Pcdhb18 UTSW 18 37489620 start codon destroyed probably null 1.00
R1519:Pcdhb18 UTSW 18 37490892 missense probably damaging 1.00
R1597:Pcdhb18 UTSW 18 37491767 missense probably benign 0.19
R1735:Pcdhb18 UTSW 18 37490769 missense probably benign 0.00
R2089:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2206:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R2207:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R4773:Pcdhb18 UTSW 18 37490454 missense probably damaging 1.00
R4837:Pcdhb18 UTSW 18 37489814 missense probably damaging 1.00
R5271:Pcdhb18 UTSW 18 37491596 missense possibly damaging 0.94
R5568:Pcdhb18 UTSW 18 37491800 missense probably benign 0.44
R5647:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5648:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5690:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5692:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5812:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5813:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5928:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5929:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5930:Pcdhb18 UTSW 18 37491935 missense possibly damaging 0.63
R6209:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6255:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6602:Pcdhb18 UTSW 18 37490480 missense probably damaging 0.99
R6699:Pcdhb18 UTSW 18 37491952 missense probably benign 0.00
R7055:Pcdhb18 UTSW 18 37490811 missense possibly damaging 0.64
R7197:Pcdhb18 UTSW 18 37490383 missense probably benign 0.06
R7289:Pcdhb18 UTSW 18 37490647 missense probably damaging 1.00
R7345:Pcdhb18 UTSW 18 37491923 missense probably benign 0.19
R7403:Pcdhb18 UTSW 18 37491897 missense probably benign 0.09
R7541:Pcdhb18 UTSW 18 37491609 missense probably damaging 1.00
R7651:Pcdhb18 UTSW 18 37490993 missense probably benign 0.00
R7670:Pcdhb18 UTSW 18 37491696 missense probably damaging 1.00
R7673:Pcdhb18 UTSW 18 37491737 missense probably benign 0.39
R7783:Pcdhb18 UTSW 18 37489821 missense probably benign 0.01
R7819:Pcdhb18 UTSW 18 37491255 missense possibly damaging 0.60
R7826:Pcdhb18 UTSW 18 37490942 missense probably damaging 0.98
R7857:Pcdhb18 UTSW 18 37491311 missense probably benign
R7866:Pcdhb18 UTSW 18 37490459 missense probably damaging 0.99
R7895:Pcdhb18 UTSW 18 37490467 missense probably benign 0.27
X0022:Pcdhb18 UTSW 18 37490273 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CGGACGGAATGGCATCCAAAACTAC -3'
(R):5'- CTAGAACCGTACATCTCGCCGAAAG -3'

Sequencing Primer
(F):5'- GAATGGCATCCAAAACTACACCATC -3'
(R):5'- GGTTGCTCGAATATCCTCAGAAG -3'
Posted On2013-07-30