Incidental Mutation 'R4837:Pcdhb18'
ID374376
Institutional Source Beutler Lab
Gene Symbol Pcdhb18
Ensembl Gene ENSMUSG00000048347
Gene Nameprotocadherin beta 18
SynonymsPcdhbR, Pcdhb9
MMRRC Submission 042452-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4837 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37489465-37494505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37489814 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 66 (V66M)
Ref Sequence ENSEMBL: ENSMUSP00000052113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053856
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055949
AA Change: V66M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347
AA Change: V66M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.7617 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Clip4 A G 17: 71,834,222 K524E probably damaging Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Cyp4f16 T A 17: 32,542,764 F124I possibly damaging Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam186a T C 15: 99,940,797 Y2522C unknown Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Hnrnpl T C 7: 28,817,337 S184P probably benign Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Olfr449 T G 6: 42,837,849 probably null Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Ranbp17 A G 11: 33,328,451 S139P probably damaging Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rttn T A 18: 89,090,415 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srcap T C 7: 127,558,962 probably benign Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tedc2 C A 17: 24,220,593 A25S probably damaging Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Pcdhb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Pcdhb18 APN 18 37491931 missense probably benign 0.35
IGL02651:Pcdhb18 APN 18 37491181 nonsense probably null
IGL02721:Pcdhb18 APN 18 37490031 missense probably benign 0.33
IGL02945:Pcdhb18 APN 18 37489995 missense probably benign 0.34
IGL03030:Pcdhb18 APN 18 37490733 missense probably damaging 1.00
IGL03346:Pcdhb18 APN 18 37489621 start codon destroyed probably null 0.99
R0206:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0208:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0680:Pcdhb18 UTSW 18 37490294 missense probably damaging 0.98
R1517:Pcdhb18 UTSW 18 37489620 start codon destroyed probably null 1.00
R1519:Pcdhb18 UTSW 18 37490892 missense probably damaging 1.00
R1597:Pcdhb18 UTSW 18 37491767 missense probably benign 0.19
R1735:Pcdhb18 UTSW 18 37490769 missense probably benign 0.00
R2089:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2206:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R2207:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R4773:Pcdhb18 UTSW 18 37490454 missense probably damaging 1.00
R5271:Pcdhb18 UTSW 18 37491596 missense possibly damaging 0.94
R5568:Pcdhb18 UTSW 18 37491800 missense probably benign 0.44
R5647:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5648:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5690:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5692:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5812:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5813:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5928:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5929:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5930:Pcdhb18 UTSW 18 37491935 missense possibly damaging 0.63
R6209:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6255:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6602:Pcdhb18 UTSW 18 37490480 missense probably damaging 0.99
R6699:Pcdhb18 UTSW 18 37491952 missense probably benign 0.00
R7055:Pcdhb18 UTSW 18 37490811 missense possibly damaging 0.64
R7197:Pcdhb18 UTSW 18 37490383 missense probably benign 0.06
R7289:Pcdhb18 UTSW 18 37490647 missense probably damaging 1.00
R7345:Pcdhb18 UTSW 18 37491923 missense probably benign 0.19
R7403:Pcdhb18 UTSW 18 37491897 missense probably benign 0.09
R7541:Pcdhb18 UTSW 18 37491609 missense probably damaging 1.00
R7651:Pcdhb18 UTSW 18 37490993 missense probably benign 0.00
R7670:Pcdhb18 UTSW 18 37491696 missense probably damaging 1.00
R7673:Pcdhb18 UTSW 18 37491737 missense probably benign 0.39
X0022:Pcdhb18 UTSW 18 37490273 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTGTGCTGACACCTGTAGTAAAG -3'
(R):5'- CAGAATTCTCAGCTCAGCCC -3'

Sequencing Primer
(F):5'- CAGAGGATCATGTGTCTCCAGAC -3'
(R):5'- TCAGCTCAGCCCGGTAAATCTG -3'
Posted On2016-03-01