Incidental Mutation 'R8050:Opcml'
ID619001
Institutional Source Beutler Lab
Gene Symbol Opcml
Ensembl Gene ENSMUSG00000062257
Gene Nameopioid binding protein/cell adhesion molecule-like
SynonymsObcam, B930023M13Rik, 2900075O15Rik, LOC235104
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R8050 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location27790775-28925410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28813344 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 146 (V146A)
Ref Sequence ENSEMBL: ENSMUSP00000110898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073822] [ENSMUST00000115243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073822
AA Change: V153A

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073493
Gene: ENSMUSG00000062257
AA Change: V153A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 42 133 2.94e-10 SMART
IGc2 148 209 2.91e-14 SMART
IGc2 235 303 2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115243
AA Change: V146A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110898
Gene: ENSMUSG00000062257
AA Change: V146A

DomainStartEndE-ValueType
IG 35 126 2.94e-10 SMART
IGc2 141 201 1.36e-14 SMART
IGc2 227 295 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,251,253 V194E possibly damaging Het
Adgrv1 T C 13: 81,413,177 N5406S probably damaging Het
Arhgef38 T A 3: 133,137,562 R416* probably null Het
Asb7 T A 7: 66,679,184 Q36L probably benign Het
Bbof1 G A 12: 84,411,217 M85I probably benign Het
Bin1 T G 18: 32,406,145 F44V probably damaging Het
Bnc2 C A 4: 84,292,336 V599L probably benign Het
Bnip3l A G 14: 66,989,202 S181P probably damaging Het
Btnl9 A G 11: 49,175,615 L374P probably benign Het
Cd109 T C 9: 78,664,351 I424T probably benign Het
Cdhr2 G A 13: 54,734,222 V1162M probably damaging Het
Dgkb G A 12: 38,124,217 E181K probably benign Het
Dnase1 A T 16: 4,037,997 D64V probably damaging Het
E130308A19Rik T C 4: 59,719,767 I433T probably damaging Het
Ecsit C T 9: 22,076,296 R149H probably benign Het
Enpep A T 3: 129,305,516 V437E probably damaging Het
Esrp1 A T 4: 11,338,767 V679D probably damaging Het
Fa2h T A 8: 111,348,185 probably null Het
Fabp1 G A 6: 71,199,972 E16K probably damaging Het
Fstl5 T A 3: 76,707,503 S624T probably benign Het
Gemin5 G A 11: 58,128,860 R1128W probably benign Het
Gm8300 G A 12: 87,517,141 R82Q possibly damaging Het
Hist1h2bg T C 13: 23,571,667 S79P probably damaging Het
Hps3 T C 3: 20,003,328 H896R probably benign Het
Hsf1 T A 15: 76,498,281 I284K probably benign Het
Igkv3-2 T A 6: 70,699,004 I99N probably damaging Het
Iqub T A 6: 24,503,785 I163F possibly damaging Het
Jak2 T C 19: 29,298,332 I724T probably damaging Het
Kbtbd3 A T 9: 4,330,408 T261S probably benign Het
Kctd20 G T 17: 28,952,758 probably null Het
Kif28 C T 1: 179,709,449 V490M probably benign Het
Kif9 T C 9: 110,519,140 L677P probably damaging Het
Klhl18 T C 9: 110,428,761 Y537C probably damaging Het
Mut T A 17: 40,943,893 I331K probably benign Het
Myo5a T A 9: 75,181,946 S1119R probably damaging Het
Napepld C A 5: 21,665,321 E366D probably benign Het
Nbea A G 3: 55,987,981 V1540A probably damaging Het
Neb T A 2: 52,221,726 I130L probably benign Het
Olfr130 T C 17: 38,067,479 S103P probably damaging Het
Olfr18 C T 9: 20,314,645 D92N probably damaging Het
Olfr458 A T 6: 42,460,830 L63H probably damaging Het
Pappa2 A C 1: 158,848,400 C925W probably damaging Het
Parp12 T A 6: 39,089,104 N562Y probably damaging Het
Patj C A 4: 98,538,964 H1198Q probably benign Het
Pcyox1 T A 6: 86,389,146 K362M possibly damaging Het
Pcyt2 T C 11: 120,610,939 Y350C probably benign Het
Pkd1 A T 17: 24,565,643 T388S probably benign Het
Prl3d1 T A 13: 27,100,028 Y193* probably null Het
Psme1 A T 14: 55,579,599 D15V possibly damaging Het
Qrsl1 G A 10: 43,874,635 R476C probably damaging Het
Ranbp2 A G 10: 58,479,619 N2054D probably damaging Het
Serpinb1c T A 13: 32,882,069 K298* probably null Het
Slc22a27 A T 19: 7,880,167 M355K probably benign Het
Spp1 T A 5: 104,440,414 H227Q probably benign Het
Stam2 T A 2: 52,719,773 N75I probably damaging Het
Tacc1 T C 8: 25,169,214 T579A probably benign Het
Tbx3 A G 5: 119,683,067 D734G probably benign Het
Tmem233 G T 5: 116,083,082 S35* probably null Het
Trim43c A T 9: 88,840,337 E12V probably damaging Het
Trio A G 15: 27,891,454 S463P unknown Het
Uggt2 A T 14: 119,026,422 D1065E probably damaging Het
Usp1 A G 4: 98,928,913 N114S probably benign Het
Usp34 A G 11: 23,446,787 E2377G Het
Virma T A 4: 11,528,643 H1243Q probably benign Het
Vmn2r3 A T 3: 64,271,293 V517D probably damaging Het
Zfp931 T C 2: 178,068,096 K166E probably damaging Het
Zp3 T A 5: 135,982,750 Y141N probably damaging Het
Other mutations in Opcml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Opcml APN 9 28901590 missense probably damaging 1.00
IGL00864:Opcml APN 9 28901591 missense probably damaging 1.00
IGL00956:Opcml APN 9 28675328 missense possibly damaging 0.86
IGL02391:Opcml APN 9 28675264 missense probably damaging 0.96
IGL03210:Opcml APN 9 28901537 missense probably damaging 0.99
R0373:Opcml UTSW 9 28813398 missense possibly damaging 0.48
R1037:Opcml UTSW 9 28903299 missense probably damaging 1.00
R1564:Opcml UTSW 9 28903316 missense probably damaging 1.00
R2094:Opcml UTSW 9 28901590 missense probably damaging 1.00
R2268:Opcml UTSW 9 28903355 missense possibly damaging 0.91
R2426:Opcml UTSW 9 28903367 critical splice donor site probably null
R2938:Opcml UTSW 9 27791386 start codon destroyed probably null 0.00
R3746:Opcml UTSW 9 28901530 missense possibly damaging 0.54
R4058:Opcml UTSW 9 28901588 missense probably damaging 1.00
R4173:Opcml UTSW 9 28903358 missense probably benign
R4882:Opcml UTSW 9 28901590 missense probably damaging 1.00
R5335:Opcml UTSW 9 28675325 missense possibly damaging 0.88
R7058:Opcml UTSW 9 28675211 nonsense probably null
R7559:Opcml UTSW 9 28903324 missense probably benign
R8250:Opcml UTSW 9 28675270 missense probably damaging 1.00
Z1177:Opcml UTSW 9 28404377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTGCCAAGACAAACAAAGTGG -3'
(R):5'- AGATTGGTCCTGAGATGGCG -3'

Sequencing Primer
(F):5'- AGTGGGATTAAAATGATGTTCATCC -3'
(R):5'- AGATGGCGTATTGATGCATTCAC -3'
Posted On2020-01-23