Incidental Mutation 'R2094:Opcml'
ID231977
Institutional Source Beutler Lab
Gene Symbol Opcml
Ensembl Gene ENSMUSG00000062257
Gene Nameopioid binding protein/cell adhesion molecule-like
SynonymsObcam, B930023M13Rik, 2900075O15Rik, LOC235104
MMRRC Submission 040098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2094 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27790775-28925410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28901590 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 193 (E193K)
Ref Sequence ENSEMBL: ENSMUSP00000110898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073822] [ENSMUST00000115243]
Predicted Effect probably damaging
Transcript: ENSMUST00000073822
AA Change: E201K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073493
Gene: ENSMUSG00000062257
AA Change: E201K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 42 133 2.94e-10 SMART
IGc2 148 209 2.91e-14 SMART
IGc2 235 303 2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115243
AA Change: E193K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110898
Gene: ENSMUSG00000062257
AA Change: E193K

DomainStartEndE-ValueType
IG 35 126 2.94e-10 SMART
IGc2 141 201 1.36e-14 SMART
IGc2 227 295 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215483
Meta Mutation Damage Score 0.4280 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,846 I169V probably benign Het
Arrdc5 A G 17: 56,297,856 S144P probably benign Het
Astn1 A G 1: 158,667,609 M92V probably benign Het
Atg5 A G 10: 44,319,548 I189M probably damaging Het
Atmin A G 8: 116,957,538 T646A probably damaging Het
Atp1a2 G A 1: 172,287,433 R262W probably damaging Het
Atp6v1g2 A G 17: 35,236,809 K16E probably damaging Het
Bex6 G A 16: 32,186,460 E29K possibly damaging Het
Casd1 A G 6: 4,608,705 Y101C probably damaging Het
Cdx1 T C 18: 61,035,912 D70G possibly damaging Het
Cebpz T C 17: 78,935,554 T224A probably benign Het
Cep170b T C 12: 112,735,730 V319A possibly damaging Het
Chrna2 C T 14: 66,149,463 R353W possibly damaging Het
Chst5 A T 8: 111,890,544 V148E probably benign Het
Clhc1 T A 11: 29,557,771 W162R probably benign Het
Csmd1 T A 8: 16,079,978 Q1710L probably damaging Het
Ddb1 A C 19: 10,612,936 M276L probably benign Het
Dot1l C T 10: 80,785,878 R455C probably damaging Het
Dync2h1 A G 9: 7,148,735 V903A probably benign Het
Eno1b T C 18: 48,047,475 V240A possibly damaging Het
Erich1 T G 8: 14,090,527 probably benign Het
Ermp1 A C 19: 29,639,928 S227A probably benign Het
Etv1 C A 12: 38,835,116 P143Q probably null Het
Gimap8 A T 6: 48,650,568 I159F probably benign Het
Gm12666 A G 4: 92,191,656 S32P probably damaging Het
Gm8251 A C 1: 44,059,730 I736S probably benign Het
Gpr4 G A 7: 19,222,578 V142M possibly damaging Het
Gucy1a1 C T 3: 82,113,332 C86Y probably benign Het
Ifngr2 T G 16: 91,561,779 probably null Het
Insrr A T 3: 87,803,181 N398I probably damaging Het
Iws1 A G 18: 32,084,666 E441G probably damaging Het
Megf10 A T 18: 57,281,713 K732* probably null Het
Mprip T A 11: 59,749,508 probably benign Het
Mrgprb8 T C 7: 48,389,205 V208A probably benign Het
Msc G C 1: 14,755,684 P22R probably benign Het
Olfr725 A T 14: 50,034,714 S230T probably damaging Het
Oxsr1 A C 9: 119,294,494 H71Q probably benign Het
Pkp2 T A 16: 16,246,967 W452R probably damaging Het
Prrc2b C T 2: 32,182,570 T20I probably damaging Het
Rasgrp3 T C 17: 75,503,141 S279P probably damaging Het
Rtl1 T A 12: 109,591,397 D1336V unknown Het
Serpina3m G T 12: 104,389,270 K65N probably benign Het
Serpine2 A G 1: 79,810,694 V182A probably damaging Het
Slc10a1 A G 12: 80,956,048 V272A possibly damaging Het
Slc25a29 A T 12: 108,827,432 N73K probably damaging Het
Slit1 G A 19: 41,606,380 R1184W probably damaging Het
Srrm2 T C 17: 23,812,429 probably benign Het
Stk11ip A G 1: 75,525,521 probably benign Het
Tcerg1 A G 18: 42,564,145 K767R possibly damaging Het
Tmem82 T C 4: 141,616,287 K224R probably benign Het
Tmprss11g A G 5: 86,499,556 L41S probably damaging Het
Trim42 T C 9: 97,366,097 N182S probably benign Het
Ttn T C 2: 76,830,088 T7430A probably benign Het
Wwp1 T C 4: 19,650,390 T259A probably benign Het
Other mutations in Opcml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Opcml APN 9 28901590 missense probably damaging 1.00
IGL00864:Opcml APN 9 28901591 missense probably damaging 1.00
IGL00956:Opcml APN 9 28675328 missense possibly damaging 0.86
IGL02391:Opcml APN 9 28675264 missense probably damaging 0.96
IGL03210:Opcml APN 9 28901537 missense probably damaging 0.99
R0373:Opcml UTSW 9 28813398 missense possibly damaging 0.48
R1037:Opcml UTSW 9 28903299 missense probably damaging 1.00
R1564:Opcml UTSW 9 28903316 missense probably damaging 1.00
R2268:Opcml UTSW 9 28903355 missense possibly damaging 0.91
R2426:Opcml UTSW 9 28903367 critical splice donor site probably null
R2938:Opcml UTSW 9 27791386 start codon destroyed probably null 0.00
R3746:Opcml UTSW 9 28901530 missense possibly damaging 0.54
R4058:Opcml UTSW 9 28901588 missense probably damaging 1.00
R4173:Opcml UTSW 9 28903358 missense probably benign
R4882:Opcml UTSW 9 28901590 missense probably damaging 1.00
R5335:Opcml UTSW 9 28675325 missense possibly damaging 0.88
R7058:Opcml UTSW 9 28675211 nonsense probably null
R7559:Opcml UTSW 9 28903324 missense probably benign
R8050:Opcml UTSW 9 28813344 missense not run
Z1177:Opcml UTSW 9 28404377 missense not run
Predicted Primers PCR Primer
(F):5'- GGGTGTTGAGCCCCATTCTATG -3'
(R):5'- GGCGATGAGAACAACCTGAC -3'

Sequencing Primer
(F):5'- GGCCATGCCTCTTCTGC -3'
(R):5'- GACAAAACTCTGCACTTTCTGTTGG -3'
Posted On2014-09-18