Incidental Mutation 'R8095:Foxh1'
ID 630166
Institutional Source Beutler Lab
Gene Symbol Foxh1
Ensembl Gene ENSMUSG00000033837
Gene Name forkhead box H1
Synonyms Fast2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8095 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 76668225-76669948 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 76669008 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 169 (R169*)
Ref Sequence ENSEMBL: ENSMUSP00000036591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004294] [ENSMUST00000037551] [ENSMUST00000037824] [ENSMUST00000135388] [ENSMUST00000230451] [ENSMUST00000230964]
AlphaFold O88621
Predicted Effect probably benign
Transcript: ENSMUST00000004294
SMART Domains Protein: ENSMUSP00000004294
Gene: ENSMUSG00000004187

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 36 45 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
coiled coil region 195 235 N/A INTRINSIC
coiled coil region 274 345 N/A INTRINSIC
KISc 407 740 3.21e-141 SMART
low complexity region 745 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037551
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037824
AA Change: R169*
SMART Domains Protein: ENSMUSP00000036591
Gene: ENSMUSG00000033837
AA Change: R169*

DomainStartEndE-ValueType
FH 62 152 2.71e-34 SMART
low complexity region 183 194 N/A INTRINSIC
low complexity region 331 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135388
Predicted Effect probably benign
Transcript: ENSMUST00000230451
Predicted Effect probably benign
Transcript: ENSMUST00000230964
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FOXH1 encodes a human homolog of Xenopus forkhead activin signal transducer-1. FOXH1 protein binds SMAD2 and activates an activin response element via binding the DNA motif TGT(G/T)(T/G)ATT. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional knockout of this gene in the lateral plate mesoderm results in death within a few days after birth. Mutant animals exhibit right isomerism affecting the heart, lungs, and stomach. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,317,222 I490M possibly damaging Het
Abcc9 T C 6: 142,644,322 I817V probably benign Het
Apopt1 C A 12: 111,722,784 A100D probably damaging Het
Atp11b T C 3: 35,834,416 L945P probably damaging Het
Crem T C 18: 3,295,106 T108A probably benign Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dnah14 G T 1: 181,806,032 E11* probably null Het
Dpy19l1 T C 9: 24,484,864 probably null Het
Dym A G 18: 75,114,801 T259A possibly damaging Het
E030018B13Rik T G 7: 63,919,301 H32Q unknown Het
Ehmt2 T G 17: 34,907,769 H809Q probably damaging Het
Fabp6 G A 11: 43,598,716 R33C probably damaging Het
Fam98a C A 17: 75,538,771 D327Y probably damaging Het
Foxf1 C T 8: 121,086,812 T357I probably benign Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hydin T C 8: 110,569,359 F3568S probably damaging Het
Il22 T C 10: 118,205,123 S45P possibly damaging Het
Isyna1 C A 8: 70,596,385 Y371* probably null Het
Lingo3 T C 10: 80,835,421 H225R probably benign Het
Lmo7 T A 14: 101,887,419 V560E possibly damaging Het
Mab21l2 A G 3: 86,547,462 V77A probably benign Het
Mapkbp1 A G 2: 120,017,650 K595R probably benign Het
Mfsd2a A T 4: 122,951,271 C216S probably damaging Het
Muc16 A T 9: 18,584,830 Y6688* probably null Het
Olfr536 T C 7: 140,504,279 Y60C probably damaging Het
Otud6b T C 4: 14,825,614 D72G probably damaging Het
Pcdhgb6 A G 18: 37,742,871 I211V probably benign Het
Ryr3 A G 2: 112,668,043 probably null Het
Sardh T C 2: 27,242,718 Y166C probably damaging Het
Scn1a T A 2: 66,302,465 K171N possibly damaging Het
Scyl2 G T 10: 89,641,103 T720K probably damaging Het
Slc9a8 T A 2: 167,468,971 V384D probably damaging Het
Smg1 T C 7: 118,173,062 Y1490C unknown Het
Snx16 A T 3: 10,438,184 M1K probably null Het
Sqle A G 15: 59,321,427 S218G probably benign Het
Strip1 A G 3: 107,618,139 I527T possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trf T C 9: 103,210,536 Y673C probably damaging Het
Ttc39b C T 4: 83,246,320 A252T probably benign Het
Tubgcp6 A T 15: 89,122,774 L15H probably benign Het
Uspl1 C T 5: 149,214,182 Q731* probably null Het
Vmn1r193 T C 13: 22,219,061 R254G possibly damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp644 A C 5: 106,618,414 V1234G possibly damaging Het
Other mutations in Foxh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Foxh1 APN 15 76668920 missense probably damaging 1.00
R0112:Foxh1 UTSW 15 76669010 missense probably benign 0.00
R0126:Foxh1 UTSW 15 76669254 missense probably damaging 1.00
R2266:Foxh1 UTSW 15 76668620 missense probably benign 0.00
R5223:Foxh1 UTSW 15 76668729 splice site probably null
R5775:Foxh1 UTSW 15 76669849 missense probably benign 0.44
R6666:Foxh1 UTSW 15 76668413 missense probably damaging 1.00
R7528:Foxh1 UTSW 15 76669311 missense probably benign 0.03
R8936:Foxh1 UTSW 15 76668519 unclassified probably benign
R9287:Foxh1 UTSW 15 76668926 missense probably damaging 0.99
R9429:Foxh1 UTSW 15 76669242 missense probably null 0.16
Z1177:Foxh1 UTSW 15 76669021 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGACAAGGTGCCTGCCTG -3'
(R):5'- AATCGGTGCTTCCATAAGGTG -3'

Sequencing Primer
(F):5'- AAGGTGCCTGCCTGAGCTG -3'
(R):5'- CCCCGAATCTCTGGGTAGAACAG -3'
Posted On 2020-06-30