Incidental Mutation 'R8095:Tmem161b'
ID630163
Institutional Source Beutler Lab
Gene Symbol Tmem161b
Ensembl Gene ENSMUSG00000035762
Gene Nametransmembrane protein 161B
Synonyms2810446P07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8095 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location84222296-84296141 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 84222418 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057495] [ENSMUST00000223827] [ENSMUST00000223862] [ENSMUST00000224525] [ENSMUST00000225069]
Predicted Effect probably benign
Transcript: ENSMUST00000057495
SMART Domains Protein: ENSMUSP00000055208
Gene: ENSMUSG00000035762

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 485 1.3e-213 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185973
Predicted Effect probably benign
Transcript: ENSMUST00000223827
Predicted Effect probably benign
Transcript: ENSMUST00000223862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224501
Predicted Effect probably benign
Transcript: ENSMUST00000224525
Predicted Effect probably benign
Transcript: ENSMUST00000225069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225212
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit lethality before genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,317,222 I490M possibly damaging Het
Abcc9 T C 6: 142,644,322 I817V probably benign Het
Apopt1 C A 12: 111,722,784 A100D probably damaging Het
Atp11b T C 3: 35,834,416 L945P probably damaging Het
Crem T C 18: 3,295,106 T108A probably benign Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Cyp51 C T 5: 4,086,490 E435K probably benign Het
Dnah14 G T 1: 181,806,032 E11* probably null Het
Dpy19l1 T C 9: 24,484,864 probably null Het
Dym A G 18: 75,114,801 T259A possibly damaging Het
E030018B13Rik T G 7: 63,919,301 H32Q unknown Het
Ehmt2 T G 17: 34,907,769 H809Q probably damaging Het
Fabp6 G A 11: 43,598,716 R33C probably damaging Het
Fam98a C A 17: 75,538,771 D327Y probably damaging Het
Foxf1 C T 8: 121,086,812 T357I probably benign Het
Foxh1 T A 15: 76,669,008 R169* probably null Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hydin T C 8: 110,569,359 F3568S probably damaging Het
Il22 T C 10: 118,205,123 S45P possibly damaging Het
Isyna1 C A 8: 70,596,385 Y371* probably null Het
Lingo3 T C 10: 80,835,421 H225R probably benign Het
Lmo7 T A 14: 101,887,419 V560E possibly damaging Het
Mab21l2 A G 3: 86,547,462 V77A probably benign Het
Mapkbp1 A G 2: 120,017,650 K595R probably benign Het
Mfsd2a A T 4: 122,951,271 C216S probably damaging Het
Muc16 A T 9: 18,584,830 Y6688* probably null Het
Olfr536 T C 7: 140,504,279 Y60C probably damaging Het
Otud6b T C 4: 14,825,614 D72G probably damaging Het
Pcdhgb6 A G 18: 37,742,871 I211V probably benign Het
Ryr3 A G 2: 112,668,043 probably null Het
Sardh T C 2: 27,242,718 Y166C probably damaging Het
Scn1a T A 2: 66,302,465 K171N possibly damaging Het
Scyl2 G T 10: 89,641,103 T720K probably damaging Het
Slc9a8 T A 2: 167,468,971 V384D probably damaging Het
Smg1 T C 7: 118,173,062 Y1490C unknown Het
Snx16 A T 3: 10,438,184 M1K probably null Het
Sqle A G 15: 59,321,427 S218G probably benign Het
Strip1 A G 3: 107,618,139 I527T possibly damaging Het
Tnfsf13 A G 11: 69,685,157 C35R probably damaging Het
Trf T C 9: 103,210,536 Y673C probably damaging Het
Ttc39b C T 4: 83,246,320 A252T probably benign Het
Tubgcp6 A T 15: 89,122,774 L15H probably benign Het
Uspl1 C T 5: 149,214,182 Q731* probably null Het
Vmn1r193 T C 13: 22,219,061 R254G possibly damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp644 A C 5: 106,618,414 V1234G possibly damaging Het
Other mutations in Tmem161b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Tmem161b APN 13 84294596 splice site probably benign
IGL01086:Tmem161b APN 13 84222422 utr 5 prime probably benign
IGL01150:Tmem161b APN 13 84292407 nonsense probably null
IGL01566:Tmem161b APN 13 84294762 missense probably benign 0.35
IGL02183:Tmem161b APN 13 84272254 missense probably damaging 1.00
IGL02481:Tmem161b APN 13 84283993 missense probably damaging 0.99
IGL02519:Tmem161b APN 13 84294744 missense probably damaging 1.00
IGL03207:Tmem161b APN 13 84294595 splice site probably benign
R6836_Tmem161b_587 UTSW 13 84222418 start gained probably benign
R0015:Tmem161b UTSW 13 84222414 splice site probably null
R0376:Tmem161b UTSW 13 84292383 missense probably benign 0.43
R0613:Tmem161b UTSW 13 84251320 missense probably damaging 1.00
R1925:Tmem161b UTSW 13 84260229 missense probably benign 0.07
R1935:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R1936:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R2325:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R2988:Tmem161b UTSW 13 84292455 nonsense probably null
R4327:Tmem161b UTSW 13 84251240 missense probably damaging 1.00
R4525:Tmem161b UTSW 13 84257802 missense probably benign 0.00
R4558:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R5133:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5134:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5727:Tmem161b UTSW 13 84286790 missense possibly damaging 0.63
R5875:Tmem161b UTSW 13 84294858 missense probably damaging 1.00
R6217:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R6527:Tmem161b UTSW 13 84272264 missense probably benign 0.06
R6550:Tmem161b UTSW 13 84222418 start gained probably benign
R6551:Tmem161b UTSW 13 84222418 start gained probably benign
R6553:Tmem161b UTSW 13 84222418 start gained probably benign
R6554:Tmem161b UTSW 13 84222418 start gained probably benign
R6640:Tmem161b UTSW 13 84222418 start gained probably benign
R6641:Tmem161b UTSW 13 84222418 start gained probably benign
R6685:Tmem161b UTSW 13 84222418 start gained probably benign
R6836:Tmem161b UTSW 13 84222418 start gained probably benign
R6837:Tmem161b UTSW 13 84222418 start gained probably benign
R6838:Tmem161b UTSW 13 84222418 start gained probably benign
R7077:Tmem161b UTSW 13 84222418 start gained probably benign
R7078:Tmem161b UTSW 13 84222418 start gained probably benign
R7386:Tmem161b UTSW 13 84222418 start gained probably benign
R7388:Tmem161b UTSW 13 84222418 start gained probably benign
R7429:Tmem161b UTSW 13 84282747 critical splice acceptor site probably null
R7430:Tmem161b UTSW 13 84282747 critical splice acceptor site probably null
R7547:Tmem161b UTSW 13 84222418 start gained probably benign
R7548:Tmem161b UTSW 13 84222418 start gained probably benign
R7634:Tmem161b UTSW 13 84222418 start gained probably benign
R7636:Tmem161b UTSW 13 84222418 start gained probably benign
R8094:Tmem161b UTSW 13 84222418 start gained probably benign
R8255:Tmem161b UTSW 13 84222418 start gained probably benign
R8257:Tmem161b UTSW 13 84222418 start gained probably benign
R8669:Tmem161b UTSW 13 84272169 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTTAGAGAACGCCTTGC -3'
(R):5'- TAGACTGGGTACTCCGACAGAC -3'

Sequencing Primer
(F):5'- TCCTCTCTGCGTGGCGTG -3'
(R):5'- TCCCTCGGCTGTCTGGAAC -3'
Posted On2020-06-30