Incidental Mutation 'R8097:Sult2a3'
ID630239
Institutional Source Beutler Lab
Gene Symbol Sult2a3
Ensembl Gene ENSMUSG00000074375
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 3
SynonymsGm6955
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8097 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location14067446-14123044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14082710 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 181 (V181E)
Ref Sequence ENSEMBL: ENSMUSP00000096407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098809]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098809
AA Change: V181E

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096407
Gene: ENSMUSG00000074375
AA Change: V181E

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 278 1.5e-83 PFAM
Pfam:Sulfotransfer_3 35 205 3.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,816,955 M749I probably benign Het
Adcy8 A T 15: 64,871,862 probably null Het
Adgrb2 G A 4: 130,007,897 C438Y probably damaging Het
Amn1 G A 6: 149,169,355 probably benign Het
Atxn2 C T 5: 121,749,223 R319W probably damaging Het
Ccdc162 T C 10: 41,634,119 E830G probably benign Het
Ccdc71 T C 9: 108,463,552 V188A probably benign Het
Ceacam11 A T 7: 17,975,530 R218* probably null Het
Col18a1 A C 10: 77,112,508 L390R unknown Het
Cps1 A G 1: 67,228,270 N1399S probably benign Het
Ctnnal1 T C 4: 56,847,845 E98G probably damaging Het
Cyp1a2 T A 9: 57,679,553 probably null Het
Cyp2d11 C A 15: 82,390,380 probably null Het
Cyp2j7 G A 4: 96,215,410 T296I possibly damaging Het
Dcc C T 18: 71,679,502 G407D probably damaging Het
E330034G19Rik T C 14: 24,306,852 L217S unknown Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 A G 10: 96,026,654 K813E probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etf1 T C 18: 34,931,644 D4G probably benign Het
F830045P16Rik T C 2: 129,463,585 T290A possibly damaging Het
Filip1 T C 9: 79,818,259 D1026G probably benign Het
Flad1 A T 3: 89,409,135 L40H probably damaging Het
Fpr3 C A 17: 17,970,792 N108K probably damaging Het
Galntl6 A G 8: 57,962,373 probably null Het
Gm30302 T A 13: 49,790,200 M1L probably benign Het
Hmgcll1 T C 9: 76,015,139 L22P probably benign Het
Iars2 C T 1: 185,329,389 probably benign Het
Ifna15 A T 4: 88,557,701 L182Q probably benign Het
Kcna6 A T 6: 126,738,612 V438E probably damaging Het
Kcnma1 T A 14: 23,330,964 D1012V probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lama2 G A 10: 27,190,664 Q1074* probably null Het
Lhx9 T C 1: 138,838,351 Y242C probably damaging Het
Lrrc37a T A 11: 103,504,099 I167F probably benign Het
Lrrc49 T A 9: 60,615,048 T351S probably benign Het
Lrrc56 A G 7: 141,195,906 probably null Het
Mlh1 C A 9: 111,256,092 probably null Het
Msh4 C T 3: 153,877,908 probably null Het
Nav2 A G 7: 49,587,777 D1999G probably damaging Het
Ncapd2 A T 6: 125,168,982 I1272K possibly damaging Het
Neurl1a A G 19: 47,257,519 D530G probably damaging Het
Nid2 T C 14: 19,798,589 V1019A possibly damaging Het
Nlrp2 A T 7: 5,327,651 L582Q probably damaging Het
Olfr1046 A T 2: 86,217,666 F15I probably damaging Het
Olfr1226 A T 2: 89,193,632 I134N probably damaging Het
Olfr33 A G 7: 102,713,990 V141A possibly damaging Het
Olfr99 A T 17: 37,279,927 Y164* probably null Het
Pde6c G T 19: 38,161,966 E520* probably null Het
Pdzk1 C T 3: 96,850,240 T4I probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Rap1gap G T 4: 137,728,286 V667F probably benign Het
Recql A T 6: 142,374,911 I137N probably damaging Het
Ryr2 T C 13: 11,945,995 E19G probably damaging Het
Ryr3 T C 2: 112,670,270 probably null Het
Six1 A G 12: 73,043,750 S214P possibly damaging Het
Slc24a1 T C 9: 64,924,452 D1121G probably damaging Het
Slc30a6 T A 17: 74,412,698 C218S possibly damaging Het
Stab2 T C 10: 86,869,095 D1803G possibly damaging Het
Ubc C T 5: 125,389,918 probably benign Het
Usp8 A G 2: 126,754,880 N870S probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vps13b T C 15: 35,709,346 I1813T probably benign Het
Wdr11 C T 7: 129,607,887 P473L probably damaging Het
Zcchc4 T A 5: 52,795,991 I114N probably benign Het
Zfp516 C A 18: 82,987,170 S733* probably null Het
Other mutations in Sult2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Sult2a3 APN 7 14122980 missense probably benign 0.03
IGL02353:Sult2a3 APN 7 14121650 nonsense probably null
IGL02360:Sult2a3 APN 7 14121650 nonsense probably null
IGL02806:Sult2a3 APN 7 14122932 missense probably damaging 1.00
IGL03252:Sult2a3 APN 7 14067634 missense probably damaging 1.00
R0029:Sult2a3 UTSW 7 14073074 missense probably benign 0.11
R1480:Sult2a3 UTSW 7 14122911 missense possibly damaging 0.51
R1491:Sult2a3 UTSW 7 14122942 missense probably benign 0.01
R4078:Sult2a3 UTSW 7 14121737 missense possibly damaging 0.94
R4668:Sult2a3 UTSW 7 14122861 missense probably damaging 1.00
R4928:Sult2a3 UTSW 7 14111557 missense probably benign 0.06
R6311:Sult2a3 UTSW 7 14111557 missense probably benign 0.00
R6749:Sult2a3 UTSW 7 14082704 missense probably benign 0.00
R7030:Sult2a3 UTSW 7 14067568 missense probably damaging 1.00
R7232:Sult2a3 UTSW 7 14082760 missense possibly damaging 0.89
R7394:Sult2a3 UTSW 7 14111524 missense probably benign 0.05
R7617:Sult2a3 UTSW 7 14073056 missense probably benign 0.00
R8029:Sult2a3 UTSW 7 14121628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAATTCCAAAATTTACACTGACAT -3'
(R):5'- GCAGTAGAATATCTCCTCATGGCAT -3'

Sequencing Primer
(F):5'- GCAAAAATAAATGACTGACTGACTG -3'
(R):5'- CTCCTCATGGCATCAATGGTAAACTG -3'
Posted On2020-06-30