Incidental Mutation 'R8122:Cyp2d11'
ID631573
Institutional Source Beutler Lab
Gene Symbol Cyp2d11
Ensembl Gene ENSMUSG00000068085
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 11
SynonymsCyp2d, P450-2D
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8122 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82389154-82394022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82392543 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 65 (Q65L)
Ref Sequence ENSEMBL: ENSMUSP00000130338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170255]
Predicted Effect probably benign
Transcript: ENSMUST00000170255
AA Change: Q65L

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130338
Gene: ENSMUSG00000068085
AA Change: Q65L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 7.7e-140 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.5%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,886,670 V672E possibly damaging Het
Abat A G 16: 8,615,897 Y426C probably damaging Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak2 T C 12: 112,776,076 S521G possibly damaging Het
Amer2 A T 14: 60,379,342 M329L possibly damaging Het
Arhgap20 A G 9: 51,849,993 N1048S probably damaging Het
Asah1 T C 8: 41,343,730 E305G probably benign Het
AW551984 T A 9: 39,599,369 K223N probably damaging Het
BC067074 A T 13: 113,318,908 D496V Het
Bptf C A 11: 107,036,591 probably null Het
C1qtnf6 T C 15: 78,527,246 N77D probably benign Het
Capn13 T A 17: 73,367,210 I83F probably damaging Het
Cd6 A G 19: 10,792,867 F487L probably damaging Het
Cit T C 5: 115,969,010 V1067A probably damaging Het
Csrnp1 T C 9: 119,973,207 D262G probably damaging Het
Dbt T A 3: 116,520,242 C19* probably null Het
Dgkg A C 16: 22,566,545 probably null Het
Eif4g2 T C 7: 111,078,553 I118V possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Gpr158 A T 2: 21,826,863 M925L probably benign Het
Kcnn2 T G 18: 45,676,938 V414G probably damaging Het
Lama2 G A 10: 27,054,596 H2055Y possibly damaging Het
Loxl3 T A 6: 83,049,259 W443R probably damaging Het
Mab21l1 A T 3: 55,783,484 D164V probably benign Het
Mroh7 T C 4: 106,702,529 T734A probably damaging Het
Olfr1392 C A 11: 49,293,574 N84K probably damaging Het
Olfr955 A G 9: 39,470,526 S67P probably damaging Het
Pkhd1 C T 1: 20,562,458 E578K probably damaging Het
Pld2 T A 11: 70,541,433 L126* probably null Het
Polk A T 13: 96,483,783 N716K probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prom1 T C 5: 44,012,953 K669E probably benign Het
Sag A G 1: 87,834,567 D318G probably damaging Het
Scfd1 T A 12: 51,433,269 V528E possibly damaging Het
Scn4a A G 11: 106,330,331 L834P probably benign Het
Shank1 G T 7: 44,333,591 G637V unknown Het
Slc12a6 A G 2: 112,266,822 M1V probably null Het
St6gal1 A G 16: 23,354,894 K242R probably benign Het
Syt3 A G 7: 44,395,729 Y495C probably damaging Het
Taar8c C T 10: 24,101,209 S235N probably benign Het
Tmem183a A T 1: 134,354,765 C201S probably benign Het
Top2a T C 11: 98,999,167 I1237V probably benign Het
Trub1 G T 19: 57,485,131 V207L probably benign Het
Ttll13 T A 7: 80,259,469 I634N probably benign Het
Ube2j1 T G 4: 33,045,145 N208K probably benign Het
Wdr17 A G 8: 54,664,976 S569P probably damaging Het
Other mutations in Cyp2d11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cyp2d11 APN 15 82392468 missense probably benign 0.00
IGL00896:Cyp2d11 APN 15 82391074 splice site probably benign
IGL02119:Cyp2d11 APN 15 82390064 missense probably damaging 0.98
IGL02234:Cyp2d11 APN 15 82390139 missense probably benign
IGL02347:Cyp2d11 APN 15 82390480 missense probably benign 0.22
IGL02352:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02359:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02876:Cyp2d11 APN 15 82389496 missense possibly damaging 0.85
IGL03079:Cyp2d11 APN 15 82390966 missense probably damaging 1.00
IGL03259:Cyp2d11 APN 15 82390020 missense probably damaging 0.99
FR4340:Cyp2d11 UTSW 15 82390022 frame shift probably null
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0101:Cyp2d11 UTSW 15 82390194 splice site probably benign
R0125:Cyp2d11 UTSW 15 82389221 missense probably benign 0.45
R0973:Cyp2d11 UTSW 15 82389529 missense possibly damaging 0.80
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1525:Cyp2d11 UTSW 15 82389297 missense probably damaging 0.98
R1708:Cyp2d11 UTSW 15 82390432 missense probably benign 0.01
R1968:Cyp2d11 UTSW 15 82389548 missense probably benign 0.01
R2117:Cyp2d11 UTSW 15 82391753 missense probably damaging 0.99
R2223:Cyp2d11 UTSW 15 82390131 missense probably benign 0.23
R2405:Cyp2d11 UTSW 15 82389266 missense possibly damaging 0.88
R3745:Cyp2d11 UTSW 15 82391855 missense probably benign 0.31
R4081:Cyp2d11 UTSW 15 82391801 missense possibly damaging 0.86
R4496:Cyp2d11 UTSW 15 82391948 splice site probably benign
R4732:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4733:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4880:Cyp2d11 UTSW 15 82392105 missense probably benign 0.01
R4898:Cyp2d11 UTSW 15 82391023 missense probably benign 0.03
R5045:Cyp2d11 UTSW 15 82391071 critical splice acceptor site probably null
R5328:Cyp2d11 UTSW 15 82391771 missense probably benign 0.04
R5356:Cyp2d11 UTSW 15 82390511 missense probably benign 0.11
R5397:Cyp2d11 UTSW 15 82392078 missense probably damaging 1.00
R5582:Cyp2d11 UTSW 15 82392118 splice site probably null
R6862:Cyp2d11 UTSW 15 82390138 missense probably benign
R7194:Cyp2d11 UTSW 15 82391768 missense probably benign
R8097:Cyp2d11 UTSW 15 82390380 critical splice donor site probably null
R8152:Cyp2d11 UTSW 15 82392487 missense probably benign
R8194:Cyp2d11 UTSW 15 82390437 missense probably damaging 1.00
R8531:Cyp2d11 UTSW 15 82389228 missense probably benign
Z1088:Cyp2d11 UTSW 15 82390111 missense probably damaging 0.99
Z1177:Cyp2d11 UTSW 15 82392499 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTACCTTGGGATCCAGGCTTC -3'
(R):5'- CTGTGCACACTCACTTTCACAG -3'

Sequencing Primer
(F):5'- TTGGGATCCAGGCTTCACACC -3'
(R):5'- GAGATCCAGCTGTAAGGCATTTTCC -3'
Posted On2020-06-30