Incidental Mutation 'R5397:Cyp2d11'
ID429771
Institutional Source Beutler Lab
Gene Symbol Cyp2d11
Ensembl Gene ENSMUSG00000068085
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 11
SynonymsCyp2d, P450-2D
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82389154-82394022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82392078 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 131 (W131R)
Ref Sequence ENSEMBL: ENSMUSP00000130338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170255]
Predicted Effect probably damaging
Transcript: ENSMUST00000170255
AA Change: W131R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130338
Gene: ENSMUSG00000068085
AA Change: W131R

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 7.7e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183858
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Cyp2d11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cyp2d11 APN 15 82392468 missense probably benign 0.00
IGL00896:Cyp2d11 APN 15 82391074 splice site probably benign
IGL02119:Cyp2d11 APN 15 82390064 missense probably damaging 0.98
IGL02234:Cyp2d11 APN 15 82390139 missense probably benign
IGL02347:Cyp2d11 APN 15 82390480 missense probably benign 0.22
IGL02352:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02359:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02876:Cyp2d11 APN 15 82389496 missense possibly damaging 0.85
IGL03079:Cyp2d11 APN 15 82390966 missense probably damaging 1.00
IGL03259:Cyp2d11 APN 15 82390020 missense probably damaging 0.99
FR4340:Cyp2d11 UTSW 15 82390022 frame shift probably null
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0101:Cyp2d11 UTSW 15 82390194 splice site probably benign
R0125:Cyp2d11 UTSW 15 82389221 missense probably benign 0.45
R0973:Cyp2d11 UTSW 15 82389529 missense possibly damaging 0.80
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1525:Cyp2d11 UTSW 15 82389297 missense probably damaging 0.98
R1708:Cyp2d11 UTSW 15 82390432 missense probably benign 0.01
R1968:Cyp2d11 UTSW 15 82389548 missense probably benign 0.01
R2117:Cyp2d11 UTSW 15 82391753 missense probably damaging 0.99
R2223:Cyp2d11 UTSW 15 82390131 missense probably benign 0.23
R2405:Cyp2d11 UTSW 15 82389266 missense possibly damaging 0.88
R3745:Cyp2d11 UTSW 15 82391855 missense probably benign 0.31
R4081:Cyp2d11 UTSW 15 82391801 missense possibly damaging 0.86
R4496:Cyp2d11 UTSW 15 82391948 splice site probably benign
R4732:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4733:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4880:Cyp2d11 UTSW 15 82392105 missense probably benign 0.01
R4898:Cyp2d11 UTSW 15 82391023 missense probably benign 0.03
R5045:Cyp2d11 UTSW 15 82391071 critical splice acceptor site probably null
R5328:Cyp2d11 UTSW 15 82391771 missense probably benign 0.04
R5356:Cyp2d11 UTSW 15 82390511 missense probably benign 0.11
R5582:Cyp2d11 UTSW 15 82392118 splice site probably null
R6862:Cyp2d11 UTSW 15 82390138 missense probably benign
R7194:Cyp2d11 UTSW 15 82391768 missense probably benign
R8097:Cyp2d11 UTSW 15 82390380 critical splice donor site probably null
R8122:Cyp2d11 UTSW 15 82392543 missense probably benign 0.27
R8152:Cyp2d11 UTSW 15 82392487 missense probably benign
R8194:Cyp2d11 UTSW 15 82390437 missense probably damaging 1.00
Z1088:Cyp2d11 UTSW 15 82390111 missense probably damaging 0.99
Z1177:Cyp2d11 UTSW 15 82392499 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACAGCGTTGTTCAGCATG -3'
(R):5'- TACCCAGAAGGCATGCACTG -3'

Sequencing Primer
(F):5'- GGGATTGATGGACTGCCC -3'
(R):5'- CATGCACTGGATTGTGATAGC -3'
Posted On2016-09-06