Incidental Mutation 'R8152:Cyp2d11'
ID633038
Institutional Source Beutler Lab
Gene Symbol Cyp2d11
Ensembl Gene ENSMUSG00000068085
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 11
SynonymsCyp2d, P450-2D
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R8152 (G1)
Quality Score205.009
Status Validated
Chromosome15
Chromosomal Location82389154-82394022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82392487 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 84 (I84V)
Ref Sequence ENSEMBL: ENSMUSP00000130338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170255]
Predicted Effect probably benign
Transcript: ENSMUST00000170255
AA Change: I84V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130338
Gene: ENSMUSG00000068085
AA Change: I84V

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 7.7e-140 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 92.4%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,458 L195P probably damaging Het
Adgrb1 T C 15: 74,541,611 V548A probably benign Het
Adgrb1 T C 15: 74,545,000 I752T probably damaging Het
Adgrb3 T C 1: 25,221,757 probably null Het
Adh6a G T 3: 138,327,514 probably null Het
Aldh18a1 A G 19: 40,565,012 S431P probably benign Het
Arap3 T C 18: 37,991,357 R310G possibly damaging Het
Atad5 T C 11: 80,095,170 V361A possibly damaging Het
Atp8a1 C A 5: 67,762,582 M380I Het
Calcrl C T 2: 84,339,249 V363M possibly damaging Het
Camsap1 G T 2: 25,940,241 D490E probably damaging Het
Cd72 T A 4: 43,452,601 I131F possibly damaging Het
Cdh2 C T 18: 16,629,519 G513D probably benign Het
Cela1 T C 15: 100,682,941 T145A probably benign Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfap99 C T 5: 34,323,391 R462C probably damaging Het
Cmtm1 A G 8: 104,309,941 S19P possibly damaging Het
Crebbp A T 16: 4,085,081 M2098K possibly damaging Het
Csmd3 T C 15: 47,669,464 probably null Het
Ctsm C G 13: 61,539,649 V100L probably benign Het
Cyp2c67 C A 19: 39,640,008 C164F probably benign Het
Cyp2j11 T C 4: 96,307,292 D389G probably damaging Het
Dctd A G 8: 48,111,690 D9G probably benign Het
Fam221a C A 6: 49,378,556 F197L probably damaging Het
Fbxl4 T G 4: 22,427,225 C489G possibly damaging Het
Fmn1 C T 2: 113,365,692 T579M unknown Het
Fndc3a G A 14: 72,574,380 L337F probably damaging Het
Frmpd2 A G 14: 33,543,287 probably null Het
Gdnf C T 15: 7,834,762 S218L probably damaging Het
Gen1 A G 12: 11,243,265 F444L probably damaging Het
Gk5 A T 9: 96,174,703 D391V probably damaging Het
Gys2 T C 6: 142,427,410 T612A probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Isx T C 8: 74,889,999 F85L probably damaging Het
Kcnh5 T C 12: 74,897,859 D872G possibly damaging Het
Kif26b T G 1: 178,679,229 V290G possibly damaging Het
Ksr2 T C 5: 117,671,458 C429R probably damaging Het
Loxhd1 A C 18: 77,388,399 I1121L possibly damaging Het
Map2 T C 1: 66,414,743 F931L probably benign Het
Marc2 T A 1: 184,841,312 M130L possibly damaging Het
Mepce T C 5: 137,784,673 I464V probably benign Het
Mpo G T 11: 87,801,649 V538L probably benign Het
Myom1 T C 17: 71,084,295 V933A probably damaging Het
Nckap1l T G 15: 103,478,530 probably null Het
Ncmap C A 4: 135,377,064 M19I possibly damaging Het
Neb T A 2: 52,183,836 I5920F probably benign Het
Nnt C T 13: 119,374,676 V355I probably benign Het
Nr1i2 C T 16: 38,252,964 G217S probably damaging Het
Nsd1 A G 13: 55,310,367 R2098G possibly damaging Het
Parp4 A G 14: 56,647,246 T1261A probably benign Het
Pcgf3 A T 5: 108,487,857 N131I probably benign Het
Plcb2 C T 2: 118,710,821 D1012N probably benign Het
Plcl2 T C 17: 50,607,661 I566T probably damaging Het
Plekha1 G A 7: 130,908,372 A283T probably damaging Het
Prag1 A T 8: 36,099,925 M77L possibly damaging Het
Rhbdl2 A T 4: 123,824,918 I222L probably benign Het
Rnh1 A C 7: 141,160,704 V446G probably damaging Het
Sash1 C T 10: 8,751,041 R193H possibly damaging Het
Sgf29 G T 7: 126,672,654 V284L possibly damaging Het
Skiv2l2 T A 13: 112,872,983 K961* probably null Het
Slc12a3 G A 8: 94,330,384 G95D probably benign Het
Slc17a7 T C 7: 45,170,290 V172A probably damaging Het
Spta1 T C 1: 174,217,944 V1556A probably benign Het
Tex15 G A 8: 33,572,893 E784K possibly damaging Het
Ttn T C 2: 76,842,788 E11224G unknown Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zdbf2 C T 1: 63,306,413 T1317I possibly damaging Het
Zfat C T 15: 68,101,506 A1147T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zhx3 T G 2: 160,780,775 I491L probably benign Het
Zranb3 T C 1: 127,954,995 D1061G probably damaging Het
Other mutations in Cyp2d11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cyp2d11 APN 15 82392468 missense probably benign 0.00
IGL00896:Cyp2d11 APN 15 82391074 splice site probably benign
IGL02119:Cyp2d11 APN 15 82390064 missense probably damaging 0.98
IGL02234:Cyp2d11 APN 15 82390139 missense probably benign
IGL02347:Cyp2d11 APN 15 82390480 missense probably benign 0.22
IGL02352:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02359:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02876:Cyp2d11 APN 15 82389496 missense possibly damaging 0.85
IGL03079:Cyp2d11 APN 15 82390966 missense probably damaging 1.00
IGL03259:Cyp2d11 APN 15 82390020 missense probably damaging 0.99
FR4340:Cyp2d11 UTSW 15 82390022 frame shift probably null
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0101:Cyp2d11 UTSW 15 82390194 splice site probably benign
R0125:Cyp2d11 UTSW 15 82389221 missense probably benign 0.45
R0973:Cyp2d11 UTSW 15 82389529 missense possibly damaging 0.80
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1525:Cyp2d11 UTSW 15 82389297 missense probably damaging 0.98
R1708:Cyp2d11 UTSW 15 82390432 missense probably benign 0.01
R1968:Cyp2d11 UTSW 15 82389548 missense probably benign 0.01
R2117:Cyp2d11 UTSW 15 82391753 missense probably damaging 0.99
R2223:Cyp2d11 UTSW 15 82390131 missense probably benign 0.23
R2405:Cyp2d11 UTSW 15 82389266 missense possibly damaging 0.88
R3745:Cyp2d11 UTSW 15 82391855 missense probably benign 0.31
R4081:Cyp2d11 UTSW 15 82391801 missense possibly damaging 0.86
R4496:Cyp2d11 UTSW 15 82391948 splice site probably benign
R4732:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4733:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4880:Cyp2d11 UTSW 15 82392105 missense probably benign 0.01
R4898:Cyp2d11 UTSW 15 82391023 missense probably benign 0.03
R5045:Cyp2d11 UTSW 15 82391071 critical splice acceptor site probably null
R5328:Cyp2d11 UTSW 15 82391771 missense probably benign 0.04
R5356:Cyp2d11 UTSW 15 82390511 missense probably benign 0.11
R5397:Cyp2d11 UTSW 15 82392078 missense probably damaging 1.00
R5582:Cyp2d11 UTSW 15 82392118 splice site probably null
R6862:Cyp2d11 UTSW 15 82390138 missense probably benign
R7194:Cyp2d11 UTSW 15 82391768 missense probably benign
R8097:Cyp2d11 UTSW 15 82390380 critical splice donor site probably null
R8122:Cyp2d11 UTSW 15 82392543 missense probably benign 0.27
R8194:Cyp2d11 UTSW 15 82390437 missense probably damaging 1.00
R8531:Cyp2d11 UTSW 15 82389228 missense probably benign
Z1088:Cyp2d11 UTSW 15 82390111 missense probably damaging 0.99
Z1177:Cyp2d11 UTSW 15 82392499 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTGTGAATTGCTTGACCAC -3'
(R):5'- TGTGCACACTCACTTTCACAG -3'

Sequencing Primer
(F):5'- GTGAATTGCTTGACCACATTCC -3'
(R):5'- GAGATCCAGCTGTAAGGCATTTTCC -3'
Posted On2020-06-30