Mutagenetix > Incidental Mutation

Incidental Mutation 'R3745:Cyp2d11'

271187

Institutional Source

Beutler Lab

Gene Symbol

Cyp2d11

Ensembl Gene

ENSMUSG00000068085

Gene Name

cytochrome P450, family 2, subfamily d, polypeptide 11

Synonyms

Cyp2d, P450-2D

MMRRC Submission

040731-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82389154-82394022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 82391855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 175 (I175S)

Ref Sequence

ENSEMBL: ENSMUSP00000130338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170255]

AlphaFold

P24457

Predicted Effect

probably benign
Transcript: ENSMUST00000170255
AA Change: I175S

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000130338
Gene: ENSMUSG00000068085
AA Change: I175S

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:p450	37	497	7.7e-140	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183858

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot9	G	A	X: 155,271,945		probably benign	Het
Akap10	A	G	11: 61,915,305	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,563,722	Y473N	probably damaging	Het
Aspn	G	A	13: 49,566,560	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060	A162S	probably damaging	Het
Auts2	A	G	5: 131,476,587		probably benign	Het
Cog6	A	T	3: 52,992,819	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Dclk1	A	G	3: 55,247,442	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732	C36S	probably damaging	Het
F5	A	G	1: 164,186,779	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790	S303R	probably benign	Het
Fam214a	T	C	9: 75,009,862	V581A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858		probably benign	Het
Gm6408	G	T	5: 146,484,436	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340		probably benign	Het
Lrriq1	T	C	10: 103,170,856	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567		probably benign	Het
Msantd1	T	A	5: 34,923,467	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485		probably benign	Het
Nbn	T	A	4: 15,976,163	C375S	possibly damaging	Het
Nell2	A	C	15: 95,432,673	C231W	probably damaging	Het
Nipbl	A	G	15: 8,358,874	S421P	probably benign	Het
Npr3	A	T	15: 11,905,491	V50E	probably damaging	Het
Olfr1425	A	G	19: 12,074,380	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421		probably benign	Het
Pkn3	A	G	2: 30,090,341	K785R	probably damaging	Het
Ppef2	T	A	5: 92,239,151		probably benign	Het
Prdm10	T	C	9: 31,340,407	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,698,185	T284I	unknown	Het
Psma3	T	C	12: 70,978,748	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365		noncoding transcript	Het
Tex11	A	G	X: 100,916,572	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741	S259P	probably benign	Het
Trpm8	A	G	1: 88,348,327	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,274,321	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,330,661	D1131E	probably benign	Het
Zfp445	A	C	9: 122,854,726	D289E	probably benign	Het

Other mutations in Cyp2d11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Cyp2d11	APN	15	82392468	missense	probably benign	0.00
IGL00896:Cyp2d11	APN	15	82391074	splice site	probably benign
IGL02119:Cyp2d11	APN	15	82390064	missense	probably damaging	0.98
IGL02234:Cyp2d11	APN	15	82390139	missense	probably benign
IGL02347:Cyp2d11	APN	15	82390480	missense	probably benign	0.22
IGL02352:Cyp2d11	APN	15	82393920	missense	possibly damaging	0.50
IGL02359:Cyp2d11	APN	15	82393920	missense	possibly damaging	0.50
IGL02876:Cyp2d11	APN	15	82389496	missense	possibly damaging	0.85
IGL03079:Cyp2d11	APN	15	82390966	missense	probably damaging	1.00
IGL03259:Cyp2d11	APN	15	82390020	missense	probably damaging	0.99
FR4340:Cyp2d11	UTSW	15	82390022	frame shift	probably null
R0066:Cyp2d11	UTSW	15	82391757	missense	probably benign
R0066:Cyp2d11	UTSW	15	82391757	missense	probably benign
R0101:Cyp2d11	UTSW	15	82390194	splice site	probably benign
R0125:Cyp2d11	UTSW	15	82389221	missense	probably benign	0.45
R0973:Cyp2d11	UTSW	15	82389529	missense	possibly damaging	0.80
R1466:Cyp2d11	UTSW	15	82391735	missense	probably benign	0.00
R1466:Cyp2d11	UTSW	15	82391735	missense	probably benign	0.00
R1525:Cyp2d11	UTSW	15	82389297	missense	probably damaging	0.98
R1708:Cyp2d11	UTSW	15	82390432	missense	probably benign	0.01
R1968:Cyp2d11	UTSW	15	82389548	missense	probably benign	0.01
R2117:Cyp2d11	UTSW	15	82391753	missense	probably damaging	0.99
R2223:Cyp2d11	UTSW	15	82390131	missense	probably benign	0.23
R2405:Cyp2d11	UTSW	15	82389266	missense	possibly damaging	0.88
R4081:Cyp2d11	UTSW	15	82391801	missense	possibly damaging	0.86
R4496:Cyp2d11	UTSW	15	82391948	splice site	probably benign
R4732:Cyp2d11	UTSW	15	82389227	missense	probably benign	0.03
R4733:Cyp2d11	UTSW	15	82389227	missense	probably benign	0.03
R4880:Cyp2d11	UTSW	15	82392105	missense	probably benign	0.01
R4898:Cyp2d11	UTSW	15	82391023	missense	probably benign	0.03
R5045:Cyp2d11	UTSW	15	82391071	critical splice acceptor site	probably null
R5328:Cyp2d11	UTSW	15	82391771	missense	probably benign	0.04
R5356:Cyp2d11	UTSW	15	82390511	missense	probably benign	0.11
R5397:Cyp2d11	UTSW	15	82392078	missense	probably damaging	1.00
R5582:Cyp2d11	UTSW	15	82392118	splice site	probably null
R6862:Cyp2d11	UTSW	15	82390138	missense	probably benign
R7194:Cyp2d11	UTSW	15	82391768	missense	probably benign
R8097:Cyp2d11	UTSW	15	82390380	critical splice donor site	probably null
R8122:Cyp2d11	UTSW	15	82392543	missense	probably benign	0.27
R8152:Cyp2d11	UTSW	15	82392487	missense	probably benign
R8194:Cyp2d11	UTSW	15	82390437	missense	probably damaging	1.00
R8531:Cyp2d11	UTSW	15	82389228	missense	probably benign
R8894:Cyp2d11	UTSW	15	82390470	missense	probably benign	0.22
R8905:Cyp2d11	UTSW	15	82390901	missense	probably benign	0.00
R9112:Cyp2d11	UTSW	15	82392002	missense	possibly damaging	0.94
Z1088:Cyp2d11	UTSW	15	82390111	missense	probably damaging	0.99
Z1177:Cyp2d11	UTSW	15	82392499	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACAGAAGTGTCTCTGTAGGCTG -3'
(R):5'- AGGCGATTCTCTGTGTCTACC -3'

Sequencing Primer
(F):5'- TCTGTAGGCTGCCCTGAAC -3'
(R):5'- TTCGGCCTGGGCAAGAAATC -3'

Posted On

2015-03-18