Incidental Mutation 'R1525:Cyp2d11'
ID167813
Institutional Source Beutler Lab
Gene Symbol Cyp2d11
Ensembl Gene ENSMUSG00000068085
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 11
SynonymsCyp2d, P450-2D
MMRRC Submission 040872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1525 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82389154-82394022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 82389297 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 458 (L458I)
Ref Sequence ENSEMBL: ENSMUSP00000130338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170255]
Predicted Effect probably damaging
Transcript: ENSMUST00000170255
AA Change: L458I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130338
Gene: ENSMUSG00000068085
AA Change: L458I

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 7.7e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183858
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4931440F15Rik A C 11: 29,823,994 Y488D probably benign Het
Abcc3 A T 11: 94,361,236 H840Q probably benign Het
Amotl2 C T 9: 102,728,568 R540C probably damaging Het
Brpf1 A G 6: 113,317,154 E605G probably damaging Het
Cacna2d3 T C 14: 28,972,242 I865V probably benign Het
Cdh24 A T 14: 54,638,589 F199I probably damaging Het
Cdk9 A G 2: 32,710,509 V27A probably damaging Het
Cfap69 G T 5: 5,640,230 probably null Het
Dchs1 T C 7: 105,758,931 E1898G probably damaging Het
Dennd4b G T 3: 90,270,870 L456F probably damaging Het
Dgat1 T C 15: 76,511,586 T66A probably benign Het
Dock10 C A 1: 80,606,164 probably null Het
Fam110b A G 4: 5,799,578 D332G possibly damaging Het
Frmd4b G A 6: 97,296,386 P628S probably damaging Het
Ice1 A T 13: 70,605,410 H852Q probably benign Het
Il17ra T C 6: 120,473,790 V116A probably damaging Het
Ints9 T C 14: 64,995,011 I173T probably benign Het
Kctd14 A T 7: 97,457,867 M110L probably benign Het
Krt6a T G 15: 101,694,202 Y16S probably benign Het
Lamc2 T C 1: 153,130,756 N883S probably benign Het
Larp4b C T 13: 9,145,450 T195M probably damaging Het
Lrp1 A G 10: 127,539,529 L4432P probably damaging Het
Mei4 T C 9: 81,890,199 S22P probably damaging Het
Mep1a T C 17: 43,491,636 Q166R probably damaging Het
Mroh2b C A 15: 4,951,130 probably null Het
Myoc T G 1: 162,648,651 L308R probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Olfr1188 C G 2: 88,559,641 S57R probably damaging Het
Olfr50 A T 2: 36,794,143 R302S probably null Het
Olfr720 T A 14: 14,175,725 Y119F probably damaging Het
Pdilt T A 7: 119,487,994 T478S probably damaging Het
Pias1 T C 9: 62,920,487 K222E probably damaging Het
Prss16 A C 13: 22,009,443 L61V possibly damaging Het
Pvr G A 7: 19,910,626 Q328* probably null Het
Ranbp3 A G 17: 56,710,865 D481G possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,908 probably benign Het
Ryr3 G T 2: 112,678,090 D3419E probably damaging Het
Scn1a C T 2: 66,319,462 W946* probably null Het
Sh3pxd2a T C 19: 47,278,425 K242E probably damaging Het
Slc34a2 A G 5: 53,069,506 D657G probably benign Het
Stard9 T A 2: 120,702,052 I2930K probably benign Het
Syna T C 5: 134,559,258 D279G probably benign Het
Tfr2 T C 5: 137,579,030 F415L probably benign Het
Tmem97 T A 11: 78,542,760 Y103F probably damaging Het
Tmem97 A T 11: 78,542,761 Y103N probably damaging Het
Txndc2 T A 17: 65,638,315 D289V probably damaging Het
Zbtb1 T G 12: 76,386,432 D397E probably benign Het
Zc3h18 T C 8: 122,413,938 S847P probably benign Het
Zfp382 G A 7: 30,133,719 G265E probably damaging Het
Zfp410 T C 12: 84,322,966 L39S probably damaging Het
Zfp729a G T 13: 67,619,321 P930T probably benign Het
Other mutations in Cyp2d11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cyp2d11 APN 15 82392468 missense probably benign 0.00
IGL00896:Cyp2d11 APN 15 82391074 splice site probably benign
IGL02119:Cyp2d11 APN 15 82390064 missense probably damaging 0.98
IGL02234:Cyp2d11 APN 15 82390139 missense probably benign
IGL02347:Cyp2d11 APN 15 82390480 missense probably benign 0.22
IGL02352:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02359:Cyp2d11 APN 15 82393920 missense possibly damaging 0.50
IGL02876:Cyp2d11 APN 15 82389496 missense possibly damaging 0.85
IGL03079:Cyp2d11 APN 15 82390966 missense probably damaging 1.00
IGL03259:Cyp2d11 APN 15 82390020 missense probably damaging 0.99
FR4340:Cyp2d11 UTSW 15 82390022 frame shift probably null
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0066:Cyp2d11 UTSW 15 82391757 missense probably benign
R0101:Cyp2d11 UTSW 15 82390194 splice site probably benign
R0125:Cyp2d11 UTSW 15 82389221 missense probably benign 0.45
R0973:Cyp2d11 UTSW 15 82389529 missense possibly damaging 0.80
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1466:Cyp2d11 UTSW 15 82391735 missense probably benign 0.00
R1708:Cyp2d11 UTSW 15 82390432 missense probably benign 0.01
R1968:Cyp2d11 UTSW 15 82389548 missense probably benign 0.01
R2117:Cyp2d11 UTSW 15 82391753 missense probably damaging 0.99
R2223:Cyp2d11 UTSW 15 82390131 missense probably benign 0.23
R2405:Cyp2d11 UTSW 15 82389266 missense possibly damaging 0.88
R3745:Cyp2d11 UTSW 15 82391855 missense probably benign 0.31
R4081:Cyp2d11 UTSW 15 82391801 missense possibly damaging 0.86
R4496:Cyp2d11 UTSW 15 82391948 splice site probably benign
R4732:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4733:Cyp2d11 UTSW 15 82389227 missense probably benign 0.03
R4880:Cyp2d11 UTSW 15 82392105 missense probably benign 0.01
R4898:Cyp2d11 UTSW 15 82391023 missense probably benign 0.03
R5045:Cyp2d11 UTSW 15 82391071 critical splice acceptor site probably null
R5328:Cyp2d11 UTSW 15 82391771 missense probably benign 0.04
R5356:Cyp2d11 UTSW 15 82390511 missense probably benign 0.11
R5397:Cyp2d11 UTSW 15 82392078 missense probably damaging 1.00
R5582:Cyp2d11 UTSW 15 82392118 splice site probably null
R6862:Cyp2d11 UTSW 15 82390138 missense probably benign
R7194:Cyp2d11 UTSW 15 82391768 missense probably benign
Z1088:Cyp2d11 UTSW 15 82390111 missense probably damaging 0.99
Z1177:Cyp2d11 UTSW 15 82392499 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCTGAGGACTCACCAAGAGAGG -3'
(R):5'- CCGTGCTGAAAGATGAGACTGTCTG -3'

Sequencing Primer
(F):5'- CACAAATCTGGTTTATTTTGCCTGG -3'
(R):5'- TGTCTGGGAAAAGCCCCTC -3'
Posted On2014-04-13